Description :
From Genome Similarity Track
Location :
Scaffold_26:8061- 10990
Transcript NameFunction/comments
Phyca_LT153417200Hypothetical protein
Phyca_LT153417201Hypothetical protein

Sequence
2929 bases(100 bases per row)
acagcgggtaagaaacacctcaactgctcctaatcaaattgtcgtttagaatcgtacaagtagaaaataaaagcagcaattaagaaaatatacattttac
atacgccgagtccgccatcacggaaataaataattaagatataaatatagacggtgaccagcttgcgaaacggtccgttgggtgcccgaagatcgtcaag
cccgcaccgatcctggttgcgcgcaagggcatcgtgtcggaaccggtggtggccgaccacgcgctggagttggtgtacgacacggcgacaaacttgaaaa
agacgttcatggtgttcaagctcattgacacgcgcgacgtgaagatggagttccggctatccggggtgcgcatctccgacgcccggccacctcaagcaga
acttcatcgacttgaacatcgacacccctcggcaggcacagtattacggcaagcacaatatcatcatggtcatcgaccaaaagaacttggaaaacgtcat
ccaaaaaatcgacaagggccacaacagcgtgcgcttcatcgcgaaggtggattcgtacatgaaggagctgtacatcgtgctcaacaacgaaaacaaaagc
gtgaaggagtaccacaccatttccttgctggggtcgtccaccgcggctgacgataaggtagtgggctcgcttccatatgcgtcgtacccgctgtccttct
cgatgccgagcaagtactttaagaaggtggtgggcgacatctccaagttcagcaaggacttcaccgtcgagcgacgcgcctgggtgccgctgtccttggc
gtacgacagcaactccaagactatcgacgtggaccacactttcaccaaggcccagctgttcaaaatcaagaccgtcttgccgggccacgagttcctctcg
accacagtccgagtagagtacacccaaagcctggcgaccgcgctgctcagtgacttcgtccacgtgttcgtggtcttgtagaccatcatgttctccttgt
ccacggtggacgaggggactttcacgttgctgctcgctgtgaaggttgtcggttacaagtgaaaaaaaggttgttttttttctcacacttattcctgcgg
taggaacgccgtggcgcggtgcacgcggaatccttggttgtggttgagcgggttacgtacgttaaaggggagttgtcgctcacatgctggaactccggaa
cgagacgcttcgacagctgcttgtccaagttgggcttttggatcgtcgacgccgcgatcatcgcggggttccccccgtacgacacgatttcgccgagctt
gtctggcatttttgataatatatatgtagaaatcttttattatagtgactgcttgagctgctccagcaagagctcgcgctggcgcttgctcagaaccttc
accagctcggccgccagcttcacgtcgctgtgtttacgagcaccgccgccgcccataaataaaacctgttgcggacgggttgccgcccaccacgacaccg
cccttgaccatgttctcaacgatgctttcttccatcttcttcgacaacggcacgtgcaagaaatgaaccgacttcacgaaagtgttaggcccactgttga
acgcctccctgcagctcaacagcaccttgccgtagatgtcggcgtcgcaaataacccaaacgtgtttcaggcgcgaccagtcgatcacctccagttcggt
gaggcactcgcgcacatgcctcggcgtgcccgacccgtcgtgcatgaacagcacctcgtccataaggaccttcaagtccaagtgttgctcggagaacggg
tggctcggcttgtggctcttgtacgcgcgcaagatcttagggatcaacgatagcttgtccgccctcaccaggtcctcgtacgcctgtttgatgctgtgca
gttgtgcggtggtctccttcttgtcgtagtgggcctgcttggtgtcgtcgacaatggtgttttggtccagcgaaacgccgcgccaagcgaggccctacaa
atcctcggcagtcaccagtgcgtcaccgcggccgggcagcgtcaagaagaaccacaacacgatcgggttcgcagacaaaaagtacttggcgtgtaggaag
agctccttgtccgtgctgtgcaagatcgcgagatcgcccgcgacagccttttcgacgttttgcaacaccttcttcgggtcgcccttcttcaagctgtccg
tnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnacacgccgtccatggtcagcatacaaatcacatcgtacaggtcgccgttggtcgccttggccaaggacaacaaactaaaa
tacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnn