Description :
From Genome Similarity Track
Location :
Scaffold_246:8061- 10157
Sequence
2096 bases(100 bases per row)
CGTTAAACTTTTCAGCTTGCAGCGCATTCGTCGTCTCTCATAACCAAATATTTGAACTGCTGAGAGCTCATGGATCGAAGCTTGCCTAAGCTTAGCCACT
CTTCTGCGATAAAAGGACGATGCCGCAAAATGAGGAATACGCCTGTTGCCCGCCACGCTTTGTTTCATAGAACCTATAAGCAAGTGGCACTTATTCGACT
CGCAGCCAGTAAACTTAATCATCGAAGCCATCTACCGCGCTTCCAAGTGTCCGTAAAGATGGACAAGCCGTACTTTGTTGAAGCCATTCTCTATCCACAT
GACATGTCGTATCTAAATGATCGCCAGCTCACAGCTTAATCCCCGTTCGGTATGTCCGACCGAACGGGCTTTCGACGATCTTTGTACGCTAACAGTATAT
TATGGTATGGTTCGTGCCCGATCTAGACACAGTGTCTAGTGCAAGCATCTACGCACATAGACGATCGATCATGTCTTAGTGGTTAAAAAAGGACGATTTT
CTAGGCACTGTCTTGTAAGTCAAAAGTTGAGCAAGCCCCTCTCTCACACTCTCCTTTTGTGCTCAACACAATAAACAAACAAGCTTCTGGTTAATGACGT
AGCGTGACGCAAGTGATGCATGTGCGATCGCAGAGTCTACGTATCAGACGTATAATACACACTCTACTCAAGATTATAGAGCTCAGAATCTAGAGACAGC
GAGGGTAGAAATTAACCTGAACAGGCGCCAAAGTGTCTGGACGTATGTTGATTGTTATGTAAAAAAGACAGTGGCGTGGTTGATAGCGGAGACTCCAGTT
GATTATACGGACATCTCCACTAACGTCACCGGCGTCAATCTTTAGAATACATAGCTGCAGCCGAGCGATGGGGACGTAGAAAGTTAGCTGTTGTCCACCC
GTGACTACGATCGATGCGCTATCTGACGGCGTAACTGCATGCCTGTAGCGTCCCTCCGACGTCAACGTCAATCTCCTTGATAGCGTCGAGTATATTGGCT
CTGTAGACATTTAAAAACCTTCAAGGCATTAACTGCATTCATAACGGATCACAGGTATGATATATATAGGCAAGTCATGACCGATGGCTGAGGTTTTCGT
TCAAACGACGTCAGCCATCGTTTCAGATTTGGCTGAACTAGATCATGAAGATGCCCCAGTGCGAAAGAACGGAATGCACTGATCAAAAGTGTGGGCTAAC
TCATACTTTTACTGTGTCAAATTTGCCTAAAGTTGCAACAGGGTGATCATGACTGATGCTTTAGTAACCATTTGTTCACATTTTATCCATTATCTATATC
CATCACACAGAGAAGTACATAAGAGTGTCGAAGGTTTTCTTTTTTAAACATGTAAGTGTCGGCGAATACTTGGGCAATGTCAGTCGTTGCAAGATCACGC
TTAACCTACTGTATGCAGTCAGGTGGCCGAACCGGTTACAAATCGTATCCAGATTTATCCGCCCGCCGGATAATAAAGATTATGAGGCATCATTCTAGCT
GGTATACTAGATGCTTCATCGAATGTTCAGATGATAAAAGATATGACAGGAACTAGGCTTGACAAATGAGGATGCTCCAGCATCTATTACTTGCGTGGGT
TCGCATATCTTGAGCTTTGACTACGCAAGCGCGTTAAGTCGAAGAAGACCATATGCATTGGCACCTCGAAATTGCGAAGGGCAAGTGCCATCAAATGTAT
CTCGAGCATTCGCTGCTGTGCTACCCAATTACCATAGTACACTTGGGAAATAGAGACACCTGCATTATAATCGCGCGTGATTCTATACGTAATTTGACCC
AGCGCAAACTAGTGACCAGGATACAAGTGGACGCGAGGCGTGTTAATAAGCCGGGTAAAGGTGTCGTGAAGCATGAGTGTGTTTATTCTCCCAGGTCTTG
TCAAGGACCTTAGTTGTGGTCAAATCATGTCACGATCGGACGCGTCGCAGCGTGTCTGTCTGTCTGCCTGGAATCCTACCGCCGCCCGTGCCTGTTGCTG
TATTGTTTCCGAGGATCGGTTTGTCTTACACTGCATGTATGAGCATAGAGCGGTGTAAATCAGTTAAATCGGACCTGTTTCGTCCAGTTCAATCTC