Description :
From Genome Similarity Track
Location :
Scaffold_153:80604- 84267
Sequence
3663 bases(100 bases per row)
TTTTAGATCACTTTTAGAATTGGCTCGTATAATAGCTACGTATTCGCTATTTAGCCGTATCATCTTTGGCGTTGCAAAGTAACTATGAACAAGACAGATT
GTGCTTAGCTTAACCCCTCTAACCCCGTATTCTGTATCCTACAGAATAAGCATTGTCACAGGACATAATATCCAGCAAACTTGTCCTCTCTTTCGAATTT
CGCATATGGATGTTTGTATAGCCGGTATTGTGCACATCTTCCTGTTAGATTAGCGATGGGAAGATAAACGGGGTTTATTCCGCGGTAATAGACGGACGAG
TATAAACCACCAACAGGTTTGAAATTCGGGTGGAAGCCTAAAACCGCCGCGTGTCAGCCACTCGTATTTTCCTTCATTCCGAAACTGCGCTGTTCAAGAC
GTCGCAATACAAGCTTTGTTGGGGCCCGTCGAGCGCGCCCAAGTGGCCAAGGACCATGGCCGAAGACGATCATGATGAGCGCCATTGTGATCTACAGGGA
AGCGAGAGCGTGTACTTTGCTCTGTAACATTGTACTAGTGGTATATTGATTCTACGTTGCGATGTTGATTACCAGACCTGGTGATCCGACCCAGACGACG
CTATGAGCTCTCGCGTGTGGCCCGATTGGCAGATCGATTGCGGAGTCAGCGCACAACCTCATCGGTTCCTACGAAGCCGGCTACAGCCGGGTCTACCGCT
ATATTGTAGCTGATGCAGTGGCTACTCAAGAGGCTACAGAAGAAGCGCTCCTCATGGTGTGGCTACACCGGAGACTACAGAAGAAGCGGTAGATGCTACG
ACGGATGCTACAGAAGAAGCTCTCCGCGTGATGAGGTTACACCGGAGATTACAGAAGAAGGGATAGAGGCTACGACGGAGGCTACCGATGAAAGCGGCAG
GAATGGAGCGGCAGTGCCGGAGGCTACAGAGCAAAGCGGAGGCTGCCAAAATGGCGATGATGGCCCACGGCTGGCGCGAACATTGAAGAGCGTGCGCACG
TGAATGTGTTGTTCGCGGCCGCGGCCAGCTCCGCCGGTACGATTCGAGCCGCGTACGCGACCGGCAATAGTTTGTAGGCACTGCGTACATGCAGTAGAAC
GGCCAACACCGCCGAGAACGGCGGCTATCGGCAGCCTGCCGCTGCCAGTATCGACCCTCAGGTCTAGATCTAGATAATGTGGCAAAATGTGTTGTTCGCG
GCCAGCTCCGCCGGCACGATTCGAGCCGCGCACGCGACCGGCAATAGTTTGTAGGCACTGCATACATGCAGTAGAACGGCCAACACCGCCGAGAACGGCG
GCTATCGGCAGCCTGCCGCTGCCAGTATCGACCCTCAGGTCTAGATCTAGATAATGTGGTAAAATGTGTTGTTCGCGGCCAGCTCCGCCGGCACGATTCG
AGCCGCGCACGCGACCGGCATTAGTTTGTAGGCACTGCATACGTGAAGTAGAACGGCCAACACCGCCGAGAACGGCGGCTATCGGCAGACTGCCGCTGCC
AGTATCGACCCTCAGGTCTACCAGTTCACAGCAGTCAGCTCCGCTCACCGCGTCGCTTGCTCGGGTGTAGAATGTATCCATCTATGTTGCTGCTGGCCCC
CACCAGGTCGCTGCTGGCGGCCACCATGTCGCCACCGCAAAGCGTTATGCAGACATACTGTACCATAGACCTCCAACATTGCTTAGAGAGGGGGGGGGGG
ATTAAGTTTGCCGACTCTGCGCTTGACATGCGGCGCGCCTCCAAGGACGCGCGCCTTTGTACGGCCGAGCTGCGGTTACGCGGCGTGATGATCGGTACCT
ACGCGCGCTCGCTCCGCCGACGAAGATGCGCCTGGTGTGTCGAAACTCGCTTCTCGGGGCAGCCGCCTTACATGTAAATACAGCGTCTTACACGCCATTA
AAAATGATTAGATATGACGAGTAAAATATTGTAGAGGACCAATAAGAATAGTTTGATATCAACATATTTTAAATAATTTGTACGGTACTACAAAAATATC
AGCTTTAGGGTTTAGTCGCTATCAGTTATTAGAGAACCTCAGACGCCGAGCCTAGATTAAAAAATCAACCAAAATAAGCTAATTTGGGCACGAAGGACCC
TGGATAAATGATATTGGGGTCGTGAACACCTAAAATAAGCCGGCCCAAGGACCCTAAAGGACCCTGGGATGAACGTTCATCCGGGTCGTAATATATATAG
GACCCTGGGATGAACGTTCATCCGGGTCGTAATATATAGTCCTAAACCCTAAACCCTAGACCTTTTTTCACAAACCTTAAACTTTCACATTACTTTTCAC
TTCTTTTTTTCCTCTTTTACTAACCATTACACAATATATTTACTTACACCTATTTTTTTCTTTCCTTTTTCTTTAAACCTTTTATCTACCTCCCTTTTTA
CATCCCATTTACTTTCATTCATCTACCTATTTACTTACCTCTCACATTTTTCTACTTAATTCAACCACTCTTTCCTTTAACCTTTTAATATAATTCACAT
TTATCATTTTTACCTCCATTTTTTTCTACATTTATATTATTTACCATTTTTACCACTATTTACTCTTATTCTTTCTCTCAACTATCCAAATCCCTTTTTA
AACTTCACCATTTTCAATCAAACACATCGTTCCTAATCAGACACTTATTTTTCACACATTTTTTTCTAAATCAACTTACTTACTTCAACTACTACCTATT
TTATACATATTCAACATTATCCACCACCTCCATATTATTTTCCAACCTCATTTTCACTTTTCATTTTATATCCACCATCCAACAACACATATCCTCCTTC
TCATACACTTTTTACATACCACATTCCACAACAACTACCTCTATTTAACTACCATATTCTCCCTCTCTATCCTACAACCCATCCTATCCAACTTATCTAC
TCTCTTTTCTCAACATCAATATCCTTTTTACATTTTAAATACGCCATTAATCCTCACCATCTCATTTACAAAATCCACATCTACTTCCACCTTATATAAC
TATATTCAACCACCACATACCTCCTCTTCATCCTACAACCCAGGTTTCTCCACCACCTCCACTCTCATTTCTCAACCTCATTATCCACTGTTCACCTCAT
ATCCACCATCAACCTACATCTCTCCCACTTCGCACACACCATTTACACACACATCATACCTACTTCCCCCTCTACTACATCCATCCAACCACCAACCCCC
TTCTCTTGCGTGGGGTGGCTCATGGGATGCGTCCGGCCATGGCGATACCGTTTGCGCTCTAATCTACGGCCAACGTACCATTGGTGCCATCGTTAGGGGT
CATGTAGCCACTGGTGGTGGGCTACGCCGCGGTCCGGAAGCGACGTGCGATCGCCGCGGGTGGCCTTCATTCCCCCCCACCGACATCGCCAGGGTCGAAT
GACCCCGCACGAGGTTCATTGGGTATATCTGACACGGTCGCCAGGGTTACCTCCGCCACCTCGGACGCGTCCCCAGCGTGTTTAACCCTCGCGAACCGTG
TTGGCGACGGGCGGGGAGGTTGGTGCGCCCGCTAGCACGGTCGTAACGCGAGATTGCCGAGGTGGCCATCTCAGGTGCAGCTCCAGCCCACATCCATCAG
CCAGCAGCCCCTGCCGCAGAGTGCCTGTCCGCCTGGATGAACCTATCCGACGCTACATCGTGG