Description :
From Genome Similarity Track
Location :
Scaffold_1816:806- 3681
Sequence
2875 bases(100 bases per row)
CACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTATGCCAACATCGACAGGTGCGTCTTCGAGTCGCCAGAGATCAAAGTTCTCGGTTGCT
TCGTCAGCAACGTGGGCGTCCGCAGACAAGGCCCAGGCCATTGCAGCATGGCCGACGCCCCGATCCCAGAGGGATCTTCGAAAGTGGTTGGGCTTGGCCA
ACTACCTTCACAAGTAGAGCGCAGGGTACGTGGGTCTCTCTAAGCCCTTGTCGGGCCTCCTTTAGAAGGACGCCGACTGGCGCTGGGAGCGAGAGCATCA
GGATGCCTTTGAAAGCGTCAAGGCCAGTGTCCAAGCGGCTCCAGGCCCTGCCGGACGAGACGAAGCCGTTCAGCGTCGTCTGCAACGCCTCCGACAATGC
AATTGGTTGTACATTGCAGTTGGTCGAGCGGGTCATCTCGTTCAAGTTCAGGCAGATCAAAGCCGCCGAGCGGAACTACCCTGTCCACGTCAAGGAGATC
CTGGCAATGAAGTATGACCTTGTGAGGTTTTGGGTTCATCTTCTGGGCTCAAGGCCCTTTGTAATCTACACACACCACGCATCCTTAACGACAGCACGAA
TTCGCCTCATCGCTCCCAACGGATGGCGAAGTGGTTGGCCTTCTTCGCGGAGTACAGCTTCCGCGTTGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCG
GACGCCCTCTCTCGGCGTCCAGATCTCGCGTCGGCCCCCATCACACGACTAACAACGGATATACATGATCGGATACGCATGGCGTATCGGGACGATAAGG
CTGTCGCGCCTATCGTCAAGTTCCTTATGGCAGGAACGAGGTCGAAGTCCGACTGGCTCTTGTCGCGACAGCGTTCACGGCTCCACCGATATGAGCTGAA
GGATGGCCTCCTCTATTACCGGGTGGAGCCCACTGATTCTCCACGGGTGGTCGTATCCAACGACGAGGATCTATAGTTCGATATCCTCGCGGAGGCGCAC
GACGCGCCCTCCAGCGGCCATTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGACCCACATGTACAAGTGGTTAAGACATGCGAA
AAATGTCAGCGGGTCAAACCCGCAGGGCACGTATTGGCTCCACTACAGAGCCTGCCCGTACCAGCTGACTGTTGGAAGTCGATGAGTCTTAAATTCATCT
GTGGGCTATCCGCCGACGGACACGGCAACACCGGAATTTTGGTTTTCGTGTGTCGGCCGAGCAAGATGCTACAAGATGGTACATCTTGCTCCAGTTCCCG
TTACTGCTACGGGCGAACAAACCGCAAGATTGTTCGTCGATGGCGTGTTCCGCTATCACGATCACCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTT
CACGGCTGCGTTTTGGAAAACGCTGTTTCCTTTACTGGGAACTCGTCTGCTGATGCCCACTGTGGATCATCCACAAACAGACGGCCAGACAGAGCGCGTC
AATCGAGTGCTCGAGGACTTTCTGGGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTAGTTGCGTTTGCGCTCAACAACGCGG
TACACGCTTCACGCCGTTCAAATAGAACGGTGTGAGCCCCGTGGACGCGTGTGTTCCTTTCTTCCCAGGTCTCGGATGTGAGACCAATTTTGCTGCGGAA
CCAAGTGGAATCCTTTATGAATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACATAGACAAA
CATGGATGAGGAAACTTAAGTGTATTTAAAGTGGGGGACTTAGTGTTACTAGATACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACA
AGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACATT
CTATGCTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGGGTGCTGACTCGCAGACCCACCTTGGCCCAGCTCCTCAAAGCGAGGGCGGGCCACAGAC
GTCGACAAATGCGTCGGAGCAGGCGCCTAAGCCTCGGTTTAAACGGCAAAGCTGCGGTCAAGACCGTACGCTGAAGGGCTCCGTTCGAACGGACCCCGGA
GCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATC
CGTCTGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGC
GGCCCGCAATGCGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTG
ACGGAGGCGGTCAACCTCGGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCAGAGTACTCGTACTCGTACGAG
GGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCAGACCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTG
AAGTGGAGGTGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAGCAGAACGGC
GGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCTCGACGGGTACGGCCGATGAATACATACCGTACCCGCGCTCAT