Description :
From Genome Similarity Track
Location :
Scaffold_125:8059- 9320
Sequence
1261 bases(100 bases per row)
CAAAGCGCGACTTGCCATCCAAGGACACACTCAAGTCCAAGGAGTCGACTTCGAGGAAAATTACTCCCCAGTCATCGCAAAGGAAATTCTGTGAATGATG
CTTACTCTCGGCGCGGTCCTCAACTATGAGATTGACGCGATGGACGTCATCACTGCCTTTCTCAATGGAGAAATCGACTGTGAGGTATACGTCAAACATC
CTCGCGACGTACTACGAGTACTTCGAAGCGTCTACGGCCTAAAACAGGTTCCACGCTTGAGGTTCCACACACTGGCTACCTACTTGCGCGAGCAAGGGTA
CACCCAACTCGTCAAAGACAGGCGTGTCTTCACGAAAGTCATGGACGGACGATCCGTTTATATCGGCGTCTATGTCGACGACCTCGTCGCCATGGCTCCC
ACGAAGGACATGACGGCAATCATCAAATATGGCCTGTCGGTACGTTTCAAAATGCACGACCCTGGCCCACTCAAGTTCATTCGTGAGAGTTCGTTGCGAA
TGGTCTCGAACAATGTGGAACCCAAGTCCCAATATGCGACCTCTATTCTCAAGAGGTTCAGCGTGGAGAACTCCAAACCTTCACCCACTCCCATGGAGGT
GAACCTCAAACTCTCTGAGTCGATGTGTCAAAACGAAACTGAGCGCGCCTACATGGTGGACAAGCCGTACCGATCTGTCGGCGGGAGCGTCATGTATCTC
ATGATCAGCACCCGACCAGACGTGGCTTACGTCGTCCAACAGCCAGTCAGTTCTTAACAAACCCTGGCCCAGCCTATTGGCAAGAAGCCAAGCGAGCGCT
TCGATATATTCGAGGCACGATCGACTACGGTCTCGCCTTGGGTGGTGAACACAACGTCACCGCTCCGCTGCACGCATTTGCTGATAGGAACTACGCTAAT
TGCGTTGACACTCGTCGCTGCGTCGCCAGCTTTGTGACATTCTACTGCTACTGGATCGATAAGAGACTACGCAGCATATTTCGCTCTACCACCTAGGCAG
ACTTATGATTATGTGCACAGTAGCACAAGAATGCTTGTAGATCAAGTAGACAGCAGGTGAGATGGGTCATCGCATCACTCGTCTATTACCCATGAGGACA
ATCAAAGCATCATCCAGGTAGTGAACAACTCTGGTCATCGTGGGCGCTCGAAACATATCGATGTGCTACCATTTCATCAACGACCTCGTCGAACAACAAG
TGTTTCGAATCGAGTACATAGATACACGACTCCAAGTCGCGGATGTCTTTACCAAACCATT