Description :
From Genome Similarity Track
Location :
Scaffold_278:8056- 11061
Sequence
3005 bases(100 bases per row)
TCGATGGCGTGACAGGTCACGTAAATGAAGAAGTCGGCCTTGCAGACCTCCCATCGTTAATTGACCTGTTGGAGCTAGACGAAATGTCTGTAGATCAGTT
TTGTCTGGCCTTAAAGGCAGGCGACTTATCCGATATGGTTGACCTTCGACCCGATGATGAGTTGAACTTCTCTTCCCTCTTGGATAATACGGTTCTTGAA
AGTACAAAGGCGGCACTCAGTGCACGAAGTGGATCATCCATTCTAAAGAACCCTTCAGATCCCTACTACTCTTTGGTTAAGGATTTTCAAGACGTGCTAT
GTCCATAATCCACCGTCTGTCTACCTCCAATAGGGGTGTACGTCATGAAATTGACTTGGTTCCTGGAACCAAATACTGCGTTATACGGCAGTGGCCTTTA
CCAAAAAAATAATGTGACGTCATTGACGAGTTTTTCAGTGCTAAGCACGCGGTGGGAACGGTTCGTGAGAGTAAGGCTCCTCAGTCTACACCGACATTTT
GTTTCAGAAAACCGAATGGATAGTGGCGTATTGTGCATGCTTATAACAAGCTCGATGCAGCCGCTATACCGGCACAAACGCCAATTCCTAGGAAATGTGT
TCTTCAGAACAACATGGCAGGGTGTACAATGTACAGTGCACTTGAACTGGTCGATGGGTATTACCAACTGCTATGCGAGCTCGTGATATCCCGCTTACAG
CGGTTAGTAACCAAGTGGTATGCTTTGGAATTGGCTGGTTATGCCCCAGAGGCTTTCAAATGCCCCGGCCACATTCAATCGTCTGGTGACACAAGTGTTT
CGCCCTCATTGAGCTCATGCACAAACATACTTTGACGACATATTCGTTCATAGTCTTGCAGAACAAGGCTGGTCAGACGTGGATGATCACATCAACCACT
TACGAGCTGTGCTCGAGTGCATGCTCACTAATAAGCTGTATGATAATGCGTCAAAATGCATCTTTCACGCGGACGAGATCCCATTTTTGAGATACTTCAT
TGGGAAACGAGGTCTTCGGGCAGATCTTGCAAAGGTGAATGCTATAGTGGATTGGCCGGTTTCAAAGAACCAAAAGGATTTCTGCAAGTGGCTTAGCCTC
GCCAATCACATAAATAAGTATAGCGAGAATTACGCTGATATGGCTCGGCCGTTGTCCAATCTCCCTAAAAAGGATGTGAAGTGGTGCTGGACTAGCACCG
AAGCAGAGTCTTTTACGGCCGTAAAGGGGGGTCTCCTACATGCCTAGACTTTGGCTTTGCCAGACTCTGATCGGCCTTTCAGTGTCGTCTGTGACGCTTC
TGATTTTGCCATTGGCTGTGCTCTGATACAAACGGATGTTGATGGACGCGAGCGTGTCATCGTTTTTGAATACCGCCAGCTGAAAGCTGACGAAAAGCAG
TATTTAGTTCATGACAAGGAGCTACTTGCTATGAAGTATGCTCCTGTCACATTCAGAGTTCATCTGCTTGGCTCTAAGCCTTTTGTAGTATATACCGATC
ATGCGTCGTTATGCACTGCGACTCAGTCGCCTCACCGCTCGCAGAGGATGGCCCGTTGGCTTTCATTCATTGCAAAATATAATTTCGAGGTGAAGTATAA
GCCGGGAAAGCAAAATACTTTGGCAGATGCGTTGTCACGCCTGTTTGGTTATGAGCTCGCTCATGTAACGACTCTGTCGTCGTCAGTTACGGATTTAATA
CGTGCGTCCTTTGCCAAGGATGATCAATGTGTAGCTTTGCTACGTGCTCTTGGCAGCGATGAGTTTAGAGACTCGGACACTAAATTGTCGGCATGATCGC
GTGCGGGGCTACATCGGTATTCCATCTATAACGGCTTGTTGTGCTATTGCACGGATGCGGAGGATACCCCGCGCATCTAGTTCCTCATGATGAATAACTT
AAGTATCCCATTCTCTATGAGGTGCATGAAGCTGCGACTACCGGTCATCTCAGTCGTGAGAAGACCTACAGCTGAGTTAGCCAGTGTTATTGGTGGCTTC
AACTCTATAAGTGGGTAAGCACTTATGTGCACAAATGTGAGACGTGCCCACGGATCAAACCCTCGGCACATGCGACTGCGCTGCTGGCTAGTTTGCCAGT
ACCCTCTTAGTGCTGGGAGTCATCAGCATGGACTTTGTGTTTGACCAGCCAAAGGACTCTGATGATAACACGGGTATTGTAGTCTTTGTCGAATGTTTGA
GCAAGATGTCTCACTTAACTGCTGTGCCAGAGTCCATTTATGGTAAGGGTACAGCTTCGCTGTTCATTGATCGGGTGTTTCGCCAGCACGCTCTGCCACT
GGCAATTGTCGCTGACCGCGATCCTCGTTTCACGGGTAAGTTTCGGAAGTTGGGTTTAAAGGTGCTCGGCACCAGGTTGGACGTGTCTACGTCGGATCAT
CCGCAGACCGATGGCCTAACCGAGCGCGTTAATCGCGTTCTCGGTGATGGCTTACGCAGAGTGTGCTCTGTCACACCTCGGCGTTGGAGCTAAATGCTCC
CTATTGTTGAGTTCGCCATGAACAATGCCGTTCATGCCTCGACAGGCTATGCTCCTTTCTACATGAATGGCGCCTCACACACCCACGCGTTCCGTTGACG
CTACAACTACGTGTCTCAGGGCTTGGTGGGGAGAGTAGCCGATCGGCTTGCTGATATCATCCCTGCTATTGTTCAAAAACAGATTAACGCATTCCTTGCA
AAGCGATTAAGTCTTACGACATGTTCGTGACGCGATGGCGGATAGCTAAGACAAACAGAACGAACAAGCAGATGCTAAAAGCAGAAGCTGTATTGAAAGT
TATGAGGTCGGTGACCAAGTCTTACTAAACGCTAAGTACCTACCTACAAATGTAGTATCTGCTGTGTTTAAGACGAAGTTGCGTCCGCGCTACATAGGAC
GTTTCGCGGTCGTGGCCAAGAAGGGCCTTGCGTATACGCTTAACTTGCCGCAAAAAATTTCGTCCACCCTGTGTTTTACATTGGCCCCCTTAAGCCGTAT
CGGGA