Description :
From Genome Similarity Track
Location :
Scaffold_253:8056- 10311
Sequence
2255 bases(100 bases per row)
CCGATAGGGGCGTACGTCATAAAATTGACTTGGTTCCTGGAACAAATACTGCGTTACACGGTAGTGGCATTTGCCAAAGGAACAATGTGAAGTCATTGAA
GAGTTTTTCACTGCTAAGCACGCGGTGGGGACGGTACGTCAGAGCAAGTCTCCTCATTCCACACCGACATTTTGTGTCAAAAAGCCCAATGGTAAGTGGT
TTATTGTACATGCTTATAATAGGATGAATGCGGCCACTATACCGGCACAAACACCAATTCCTAGAAATGATGTTCTTCAGAACAACATAGCAGGATGTAC
TATGTACAGTGCACTCGACCTGGTTGAAGTATAGTATCAAATGCTCATGCGAGCAAGCGATATCCCGCTCACAGTGGTTAGTGCTCCAATAGTTATGATT
TGGGAGTGGCTGGTTATGCCCCAGGGCCTTTCCAATGCCCCGGCTGCATTTAATCGTCTGGTGACGCAACTTTATGCACAAAAACGTGTTTTTATGACAT
AGTTGGTTATAGCCGAGCGGAACAGGGTCGATCGGACGTGGATAAATACATCGACCATTTACGAGCTGTGCTCGAGTGCATGCGCACCAACGAGCTGTAC
GCTTATGCATCAAAATACATCTCTGGTGCCAACCAGATCCCAATTTTAGAATGCTTTATTGAGAATTAAAGTCCTCGGGCGGATCCCGCAAAGTTGAAGG
CCATACTGGATTGGCCAGTCCCAAATAACCAACAGGATTGCGCAAGTGGCTTGGCATTTCTAATTACTTGCACAAGTATAGCGATAACTACGCGGATATG
ACTTGGCCATTGTCCAATCTCCTTAAAAAGGATGTGGGGTGGTGCTGGACTAGCACCACAAAGGATGCTTTTAATGCCATAAAGGAGATTCTCCTACATG
CCCCGACTGTGGCTTCGCCAGATCTGGTCGGCCTTTCAGTGTCGTCTGTGACGCTTCTGATTTTTCCATTGGCTGCGCTCTGTTTCAACAGATGTTGAGA
GACGCGAGCATTTCATCGCTTATGAATCCCGTAAGCTTAAACATGCTGTAAAGAACTATCTAGTTCACGACAAGGAGCTACTTGCTATGGAGTGTGCCCT
AGTCAAATTCAAATTTCATCTGGCTCCAAGCCTTTTGTAGTCTAAACAGATAATGCGTCTTTACGCATGGCGACCCAATCGCCTCACCTCTCGCAGAGGA
TGACCCATTGGCTTTCATTCTTTGCAGAATATAACCTCGAGGTGAAGTATAAGCCGGAGAGGCAAAATACTCTGGCTGATGCGTTTCACGCCGGTCTAAC
TATGAGCTTGCTCATATTACGATTTTGTCGTCGTCAATTACTAACTTAACCCGTGCATCTTATGCAAAGGATGACCAATGTTTAGCTTTGCTACCAGCTC
TTATAAGCGATGAGTTCAAGGAATCAGACATTAAATTGTCGGCACGTTTTCGTGCGAGGCTACATCAATATTCTATCGGTAATGGCCTGTTGTGCTATCG
CACGGTTGTTGCAGATACCCCGCGTATCGTTGTTCCTCATGATGAAGAACTGAAGTATTAAATTCTCTGTGAGGTCCACGACACAGCGATTAGCGATCAT
CTCGGTCGTGAGAAGACCTACGTCTTAGTCAGCCAGAGTTATTGGGGCCCAAACTCTATATATGAGTAAGCACTTATGTGCGCACATGTGAGACGTCCCA
CCAGGTCACACCCCGGGAGCATGCGGCTACGCCGCTGGCTAGTCTTCCTGTACACTCTGGGTGTTAAGAGTCCATCGGCATGGACTTTGTTTTTGGCCTA
CTGAAGGATTCGGGCGGCAACACAGATATTGTGGTCTCTGTTGACCGTTTGAGCAAAATGTCTCAATAAGCGGCTGTGCCGGACCCCATTGATGATGAAG
GTACGTACAGCTTTGCTGCTCGTTGATCGCGTGTTTCGACAACGCGGTCTGCCACTAGCAATTGTCTCTGACAGAGACCCTCGTTTATCAGGTAAATTTT
GGAAGTCCATCTTTAAGGTGCTCGGCGCCAAATTAGACATATCTACAGCGGCTCACCCGCAGACCGATGGTCGGACTGAGCGCTTTAATTGCGTCCTGGA
AGATGTCGTACGCAGCATGTCTGTTGATACGCCTCGGCCTTGGAGCTCAATGCTCCCCATCGTTGCTTTCACCATGAACAATGCTGTCCATGCCTCGACA
GGCTATACTACGTTCTATGTGAACGGCCTCACACAATCCGCGTTCCATTGACGCT