Description :
From Genome Similarity Track
Location :
Scaffold_11:80530- 81541
Sequence
1011 bases(100 bases per row)
TAAACACTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCGGCATGCCATGGTGTTTGAACACCACGTCAACGAACAG
ACGCGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACCACAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAATGCCCGTGTTCCCCTGG
CTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCCGTGGAGTTGGTAGTGGCTGCAAGGGAGCCTGCGCGAAAGGCGCAG
ACTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTGTACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTT
CTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCGTACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACGCGGTCCGCGTTG
TCGTCGACTGCATTGTAGAGTAATAACCCGTCGTGCACCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAACTTCTGACGAGCTTTGTCAGAAG
GCGCTGAGCCGTAGGCAAGCAAGAGCTTCGCGTCCACGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACGTTGGGGTGCTCGATCGCAT
GGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACC
CGGAAGTTATACTCTGCGAAGAAGGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAACGACGCGTGGTCCATATAGA
CCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTGGTTGCGCTCAGC
TGGCTTCAGCT