Description :
From Genome Similarity Track
Location :
Scaffold_54:80510- 83667
Transcript NameFunction/comments
Physo_137435hypothetical protein

Sequence
3157 bases(100 bases per row)
AGCAGTAGATCCGAAACGCGGCCAGTGCATGAACGATGGCTAACAACTCCTGTTGTTGCGTTGGGTAGTTGAGCTCCGCAGACTTCATCTTCCGACTGGT
GTACGCAATGGGACGCTCGACACCATCGACGACTTGAAACAGCACTCCACCTACGGCGAACTTGCTCGCGTCCGTCCGCAGATGCATTGGCTGGCTGAAG
TCCGGGAGATGCAGCACTGGTGGGTTACACAACCTCCGCTTCAACTCCTTAAAATTCCTCAACTGCACGTCGCTGAAGTGAAGCTTCGCGTTGCGCTTGA
TCTTCTTCTTCAGGAGGGCGAACATGGTTGCCGTGACCGAAGCGTATTTCGGGCAAAAGCGTTGCACGTAGCCAGTCAGACCCAGGAAGCTGTGAAGCTC
CTCTTGGGTCCGCGGCACGGGCCAGTCTTTGATGGTCTGCACCTTGTCGGTGTCCATCCGAACTCCGTTACGTCCCACGAAATCACCAAGGCATGGAATC
TCGTCGGTGCAGAAGACACACTTGGACAGTTTGACGTACAGCTTGTTGTCGCGCAAGATATCCAACGTCCGTGCAGCGCCTCCAAATGGTTTTCGATCTT
CGGTGACTTGATGAAGATGTAGATGTCATCGTAGAACGACTTCGTGTTCTTCAAGTCTCGGAACAGCTTCGAAGTCAACCGGTGCATTGTTGCTGGCGCG
TTGCAGACTCCCATCGGAAGTACAAGATACTCCCACAGTCCGTTTGGCGCCTGGAAAGCTGTGAACTTGATGTCTTCCTCCCGCATACGCACTTGGTAAT
ACGCGGACATCAGATCCATAGTGGAGAACCAGTACGCTCCAGACATGGCGTCCAAGATGTCTTCCTTCCTCGTCATCGGGATGCTCTGGCGCACAGTGTT
TGAATTGAGATACCGGTAGTCGTGAACGATTCTCCATCCGACTGGTTTCCGGACACAGAATGTCGGTGCTGCGTGAGTACTGATGCTTGGTCGGATGAGC
TTCTTCTTCACCATGTCTTCGACCCAACGCACGATCTCACGCTGCTGCTCAGGAGACTGTCGCCACTGTTGTCGGTACATCGCCAGATTTGGATCCTTCA
CATCAATCCGGTGCTCAATGTCGCGCTTCTCTGGTAAACCTTCGGGTAGCTCAGGACGGAACACGTTGTCCTTGTACTCCGTTAGGAGGTCGAAGGCTGG
ATTTTCACGGAAACTGTCCCAGTCCGTTTCCAGATAGCGATGTGCTTTCGCACTACCAACATTGTCGGGTTGGTCTCGTCGTTGCAGTGAGCGTGCAGCT
TGCTTGATCGTCTCGTTCGAGAGCACCAACATGAAGTCAGGCTCGTCGCTCGTCTTGGTCTTAATTCTCAGGAACTTCCGCAGTTTCTTGCGGGTGATGT
ACTTGGTCTGCACACCACTATCGTCGACAACACCCATCGTGAACATCTTCTCCACGACGTTGTCTCCACCCCTGGTACTGCTTCTTTCGTCGGCTTCTCG
TGCAGTACTCTCGCGTTCTGACGTCGCAACGTCGTCTTCTCCAGCTGAACACTCGCCAGCTTGCGGGTCATCTCCTCGTCGTCTGCTGACAACGGTCGGG
GTCTCCTTCTGCACTGCGTCGCGAACAGCTTCGCACGTGGACTTCACATCCGTTTCCAGTGCGGCGCCTCGACAGGAATCGGGTCTTTTCGCCGAAAGGC
CTTTCGCCTCGACAGTTCTCCGAAGCCCGGAGGCAATCACCGGTCCGCCTTCCTCGATCGGTCCACAGGTGTCACTTGTCCGCTCCCAGCGCAGAGTCCT
CGTTCTCGTTCCTTCGATTCATCGACCTCTCCAGTCAATACGTGGTTGCATGTCTTCGAAGAATGGTATTCCAAGAATGCAATCGAATTCGTCTGGAATC
GGGTAGACGACTGCCACACACTTGTAGGCGTCGTCCAGCCTCGAGACCAGAATCTCTATCGGCAGAACTTCAAGCTCCGCCTCGACAATTTGGTTGTCTC
CCAGCTTGACACGAATGTTCTTGTCGCTGAACTTGGTTGTCTGAAGCTGGTGCTCCTCGACCCAACGCTTGGATACGTAGATCGTGGTGGCTCCACAGTC
CAACAACATGCTTCGTGTCGCGAGACACCTGTCACCAACACTGATTTCACCTGTTACGGAGAACAGTGGACGTGACTTGTAGACCAGGGGGTTTTCGCAC
AGAACGTTCAAGCTGATATTCTCAATCTTTGGTGTTTTGGTTACGCTCTCAGCCACGACAGGACCCTCCTTCGCTGACGTGGTTGCCCGTTTCCCTGTTT
CTCCTGGTCTTTCTTCCTGAGAAAGCAGTTGGTCTTGATGTGACCAGGCTTCTTGCAGTGAAAGCAGGTACGACCCTCGGCGCGTTTGGGCTCAGCTCTC
GGCTTGAAGCGGCCTTTCCCGCGGAACGGCTTCCCCTTGAAGGGTTTACCTTGGGCGTGAGGTTGATCAGCCGACGAGAACTTCTTGTCGCGCTTGGGTT
GACGGTCGCGAGCTTCTTCGACGAAGTGAGTCACCTCGTACTTGACAGCCAAGTCCATAGCGTCGCTCAGGGTCTGGGGGTTCTCGAGCTTGACGTATCT
GCGCGTGCGAGGCTTGAGACCGTTCGCGTAGTACAGCACTTGGTCGAGTACGCTCATGCCCTCCACTCTGAAGATGAGAGCTGAGTACTCACCGTTGTAC
GTCTCAATGTCTGCTACCTGCTTGAGTCGCTGAAGCTTCTCGCGCAGGACAGCCTGGTAGTTCGATGCCTCGAAGTGTTGGAGCACATGCTCACGGAAAA
TCCCCCACGTGTGCTCCTCGCTTCATGTCGTCGACGACCAGTGCAGGAACCAACCGGAGGCAGGCTTCTCCATCGCCGACCCCGCGATTCCTGGTAGTCG
GGTGCTTGCGTCTTCGATCGGGATGTTGTTGATTCGACAGGCGTTCTCGATCTGGAACAGCCATTCGCGGACATCCTCCCCTCGCTTGCCGGTGAACTTC
GGCAGGTTGCTCGGCACTCGCGTGCGGTCCGCCATCGCTTGGTTCAGCCGATCGATCTCGGCGCGTAGTTGGGCGATGGTGGGCATGGGTTTCTTGTGGT
CAAGTTGCTGGGGTCAACAAGTGCTACCAGTTTGACAGGAAGAAGTGCTGTCTTGGG