Description :
From Genome Similarity Track
Location :
Scaffold_82:8051- 12256
Transcript NameFunction/comments
Physo_140100hypothetical protein

Sequence
4205 bases(100 bases per row)
AAGTTTGAATCTGTATAGACCTCGATGTGGAGCTTGCCATATTTCCTAGCTTCCACCAAATCGTACGCGAGACCCATGTCCTGGCTGCCGACCAAATATC
GCAGCACTCTTTTAGCTGCTCTCCAGTGTACAGCACTGTACTTTTCCAAGAACTTGCTCAGCCTTCGAATTGCTGTAGCTAAGTCCGGACGAGAGCCGCT
CACTAAGTACTGCAAGCATCCGACCAAGCTACGATACGGCAAGCACTCATCACGATTGTGCTCGTCATCACTAGCTGGTTTCAACTTCGCTACATCAGTC
GTCATAGGAGTGCTAACAGGATAAGCAGCATCCATACGAAACTTCTGCATGATGTCTTGCACATACTTCGTCTGCTGAAACATCACCCGAGTTTCCGACT
CATAAGTGATCTGCAGGCCCAGCAAATAGTTCACGGTTCCAAGATCCTTCATGTTAAAGCGAACCATCAACTTATCAGCAATAAAATTCACATCTTGTTC
ACAACCAATAAGCAAAATGCCGGCTAGGTAGATCGGTAGGAGCACCAGACGTGTCTCCACGCGGATCCAGTAGAGAGCTTCGTCCTTGAAACACCGGCGA
AATCCAAACTCCACCAGCGCCAAGTGCAACGTGCTGTTCCAGTTCCTCGGTGAGTGCCGCAGACCGTAGATGCTGCGCTTCAACAGGCATACCCAGTCCT
CTTAGCCGCGCTTTACATGACCTTGAGGTTGCTCCATATAAATCACACGATCAATGGGCGCGTTGAGGAACGCTGTGACGAAGTCGAACTGCTTTACAAC
GGCTTTCGTCAGGCAAGCGTACAACAGCACAAATCTGAGCGTCTCAAAACGCACAACAGGAGCGAACGTGTCGTCAAACTCCAGCCCCCAAATCTGAAGG
CATCCCAGAACTACCAATCTTGCTTTGAATCTCAGCAGTCGGTGTTCATTCTCCTTAAGTACCCACACCCACTTATTCTTCAGCACATGAGCGTGCTTCA
GCCTTGGCACCAAAGTCCACGTTCCGTTCTTCAGTTGTGCTAAGAACTCCTCCTTCGTGGCATCCAGCCAACGAGAACACTGCGGTGAAACTATCATCTC
CGCCCACGTCGCTGGAACTTGCAGTCGAATCATGGCTGTCGACGACGCAGACGAGCTGAACACACTCGCGATAAAGTCCTTCAAGCGCGCAGGCTTCTTC
CTTTCGCGCTGAGACCGACGCGGCTCGCTCACTTCCACCGGCAGGTGTCTCTTTCGTTTGCGTACAGGCTGCTTTTCTTGAGACTCTCTTCCTTTTCCTC
AGTATCTTGTGTCGCGCTATCACTTTGGTTCACATTCCCCCTTTGCGTCGGCACATTATGAAAGTCATCGATCTGAACAGCAGGAGCAGCGCTAGCCGAA
CGCTCAGCTGCAGCTTCCCCACTCTCATTAGAGTCAGCCAGCTCTGCACTCTCACTAGGTTCAGGTACTTCTGCAACAGGCAAATGGACAAACGGCAGTT
TCGTGCTGTCAAAATCGGGTCTGTGTCTTTGGCGATAGACCACGTTCAACAGCTTCTCCACATATTCATTCGATACAGTCGTTTCCTCAAAGAACTTCAC
GTTCTCCTTCCGATGCTCTGTTATCAACCCATTGGTCAAGTCAAGTAGACGATACCCCTTGGTCTTACTTGCGTAGCCCACCATCAAAGCAGGAGCACCT
CTCACCGATAGTTTGGTCTGTCGGTACACGTTGTCTACGAACTTCAACGTCAGACAACCAAAAGGACGCAAGTGCCTCGCGCTCGGCTTCACGCCGAACA
TCTTCTCATGCGGCGTCAAGTTGCCCTTGTTGCCTTTCGTGCTTGTGCGGTTGATTGTCTCAACCACGTACGCGGCGGCCACACCCCACAACATGCCGAG
CTGTACAACACAGCTCTGACCTTGTTGAACAATGTACTGCGGGCCTTATCAATCAAACAGGCCTCTTCAGGTGTGTGCGGATGCGAGAATATCTGCAGCG
ATTCACCCCTCAACTGCTCCGCCACTTTCGTGTTCACGAACTCCGGGCCTTGATCCGAGTGAAAAATCCTCACATCTTTATGATGCTTCGCCTTCACGTG
GTCGCGGAAATCACGTAGTCGATCCACAGTTTCCTCCTTATTCTGCTGCAGGTATAGCCACTGGTACCGTGAGCCTTCATCTATCAGGTGCAAATACACC
GAGTGCTTCTCTAGCGTAGGCACGTCGATGAAATCCAGGTCCATGAACACTTTGTGAAACGGTACTGTAGTTCGCTCTGGAGCAGTTTTCCGATGCGACA
CCCGCTTCATCTTGGCCATATCACAGTTGTAGCAGCCTCCTTTGAGTTTCCTATCATGCTGCTTCAAACGCATGCCCGTCAGGAGTTTCTTTGCCTCCAT
ATCTTTGACTGTCTGCGTGCCAAGGCTTCAAAGAAGACGAGGGTGGTGGCTGGGCAGCAACCTGCAACACTGGGTACGATTCACAGGGACGAGATATTTC
TACCTTCGACTGATACAAGCCGTCAACCATGTCGTACTTCTAGTTGTAACTCATCACTTGGTTAGTCAACAGGTTCGTCTCCTGATCGTCACTAGTCTGC
GATTTGAATCCGTGCTGTAGATACATCAACCGCTGCGAAAGGATGTTGGTAGCTCCATCCACAAACAAAGCCTCAACGGTGATCGGCACTTTCATCTTTG
TGACCGCATCTACCATCACCAGCTTAATCAGCCCCTAATACATGGGCTTCAGCGTCGTTGATTTCTCCACCCACTTCATCACAGTGTCGTTGTCCTCAGT
CATTGAGAAAAACGCATCGCGACATCCACAAATGTTCACTCCAGATGCATTGTCCAAGACGAACGACAAGCAAAAGCCAGCAGCAGACTCAGTCCTGGAT
GATAGACAAGGCGCATCATCACCATGAACAACTTCAATCATGTGAACAGGCTTGCCCTTGGGCTTTTCCTCACACGGGTTGTGATACCCTGGCAGATCGC
CATGGGTGTCTTTATTTTTGCCCTTAGCAGCTTTCTTGCCCTTACCCTGCTTTCCTTTAGCTGGCTGGTCCTTCTTCGAAGCCGTACACTCACGTTCGTA
GTGGCCCCACTTGTTGCAGTTCCAGCACTTGATATTGGAACGACGCCGCTTTTGCTGTCCACCTTGAGCAGCTCCACCACCGCCGGAATGGCGCTTCTTG
TTCCCGTGGGTGTAGAAGGCACTCTCCCCGTGCGGATGCTGCTGGTGGTGCGCTCCACCTGAATGCTCACTGCTCTTCCGAGCACGCGCCTCTGATACTG
CCTTCGCTTGCAGTAGACGGTCTTCTCTGCTGGTCAACTTGACATTAACTTGGTTCAGGGTGTAGTCGTCAAGGTTGTCAAAAGTTTCCACCAGATTCTC
GCCCAGCCCAGTCAATAAGGCTGTGATCACCTCACGGTCAGAAACTTCCCCCCCATGAGAGTTAATTCCTGACGAATGGCCTCAACACGGTGGATGTAAT
CACGTATCGACTCGTGTTCACCATCGAACTCCACATTGAGCAACTCACGCTGCTTAAAAAGGGCTACAGCAAACGACTTCTTCTCGAAGTCCTCCACCAG
AGCACCCCACTTGGCCTGCGGGGTGCCAGACGCACGCGCGTTCCGTCGTCCAGCGTGTTCGTGAGATTGTCGTTGATCATGAGCACCCTTTGCTTCCACT
TCTTGCGACGCGCTGCCGCCTCAGGAGTTCCATCACGCTCGGGCTTGGTTCGTTTCCCGATGAGAATCTCCCAGCATTTCCGAGCCATCAAAGCCGCCTT
CAATCCTTCCTTGTAGGCGATAACGTTCTTGCCGTCGAATCGAAGAGAGCGAACGGTGTCAACTCGGCCGCCGTCCAGGCCCCTCTGGTTTGGGCTCATA
ACCATGAGTTACTTGTACTTCGCAGGGCACACAGGAACAGCAAGAACTTGTCTGCACGGGCAAAGGCTGACTTTATTAGCGGTCGTTAGCTTTGTTCTCT
GCTCGGCAAAAGGCGGAATGATCTTGTTTTGGGTGCGGGGACTCGAGCCGTTAGAGCTCACACTTCACCTGTCTCTGTAATAGGCAAACCCCTAGCGGCT
AGTGCCCAGCAGAGAAGTCGTCGTTTCTCATATCGCCTGCTCCGGTGGAGAATGCATCGATCTATGTTGCTGCTGGACCCCACCAGGTCGCTGCTGGCGC
CCACC