Description :
From Genome Similarity Track
Location :
Scaffold_37:8051- 9450
Sequence
1399 bases(100 bases per row)
GACAAATGGCGTGCCGCCGCCCAAGACGAATTTCAGTCCCTTCACGACAACAAGACCTACAATCTTGTTCCACGCCTAAAGATCATGACAGTCCTACCCT
GCCGATGGGTCTTCCGCATCAAGCCCAACGGCACGTACAAAGCACGCCTAGTTATCAAAGGTTTTCTACAACGCGAATGTGTTGACTACGACGACATCTT
TGCGCCTGTCGTACGCCTTGAAGTCCTCCGTTTTCTTTTCATTATGGTGGCTATCTACGACCTTGAGTGTCATCAAATGGACGTCAAGACCGCCTTTCTC
AACGGGACCATGGACCGCGTCGTCTACATGGAACAGCCGCCTGGTGACCTCGTGACCGACGCCTCTCGCCGAGAATTAGTTTGCCGCCTAAAACGCAGCC
TCTACGGTCTCAACCAAGCGCCAACTTATGGTACTGGGCCTTCGTCGACTATATGACATCCCAAAAGTACACTCGCCTACACAAGGACCGCTGCGTTTTC
ATCAAGTCCGACGCCTCCGGTTTCACCATTGTCAGCCTTTACGTGGACGATCTTCTTATTCTTGCGCCTACTCTTTCCCTCGTCCTCGCCTTGAAGGCTT
CCCTCTCTCAACGGTTTGCAATGAAAGACCTTGGCGAAGTCTCCGACATTTTGGGATGGCAAGTCGAACGCAACGGGGCAGCCAAGACCATCTTTCTACA
CCAATCTCACTACGCCGAAGCCATCCTGGACCACTTTGACATGGTGAACTGCAACCCAGTTTCTACGCCTTTTAACCCCAGCCTCACTCTATCCGCTTCC
CATTGCGCGACGACGCCTCACGACTTCGCCTTTATGATCGGCAAGAACTATCGCTCTGTCGTCGGCAGCTTCATGTACTTAGCTATGGGCACTCGCCCCG
ATCTCGCCTACACTCTCCAACAACTCAGTCAGTATCTCCACAACCCTGGCCCTACTCATTGGTCTGCCGTCCAACGTGCCCTTCGTTATCTCAAAGGCAC
CTGCACCTATGGCATCCGCCTTGGTGGCATCGCCTCTATTGACGACTCTCCATTTTTATCCGCATATGTCGATGCGAACTATGCTAAGTGTGTTGACACT
CGACGTTGCATCAGTGGATATTTTACCCTTTTTTTCGGCTCACCCGTGTCATGGTTTGCCAAGAAGCAACCCCTCGTCACCCTGTCCACCACGGAAGCTG
AGTTCGTTGCTATCGCCTTATGCATTCAAGAGCTTCTATACCTACGTCAACTCGCCTCCGAACTCCAGCAAACGTCTGATCAACCTGTCGTCGTACATGA
AGACAACCAGTCTACTATCAAGATCGCTACCAACGCCGAACTCCACGGCCGTTCAAAGCACATCGACGTCCGCTACATGTTTGTACGTGACCTTGTGGA