Description :
From Genome Similarity Track
Location :
contig_87:80509- 82235
Transcript NameFunction/comments
g10507.t1ABC transporter-like protein

Sequence
1726 bases(100 bases per row)
CCGAGCGTGCTCAGCTGGAACAACCTTAGCTACTTCGTGGCCTGCCCCAAGTCACCTGAGACTCCTACAGGCAAGAAGGTCATCCTGGACAACGTCCGCG
GCCGCTGCGCGCCTGGAGAACTCACGGCCATCATGGGCCCGTCCGGATCGGGCAAAACCACACTCGTGGACCTGCTGGCCGACCGCATCAGCTCCGGAGA
AGTGACGGGCGACATCGAACTCAATGGTGAGGCCCGCGTGACCAAGACGTTCCGCGCCGTGACGAGCTACGTGGCCCAGGAGGACTCGCTGCTCGGGTCC
TTCACGGTGCTCGAGACCATGCGCATGGCCGCCAAGCTCAGTCTGCCCACGAGCGTCTCGACGAGGCAGATCGAGGCCCGCGTGGACGACGTGGTGGAGG
CCATGGGGCTGGCCACGTGCCGCCACACACTCGTGGGCGACATCTTCCGCAAGGGCCTCTCGGGCGGCCAGAAGCGCCGTCTTAGCATCGCCATCGAGCT
GCTGTCGAACCCGAGCATCCTCATCCTGGATGAGCCCACGAGCGGCCTGGACTCGAGCGCCACGCACAACGTCATGAAGTTCATCGTCAAGCTCTGCGCC
GAGGGCAAAACCGTCGTGTGCACCATCCACCAGCCTTCGTCGCTGGTCTACGACATGTTCACCAACGTCGTGGTGCTGTCGGCCGGCCAGACCGTCTACT
GCGGCCCGCGCGGCCACATGATCCCGCACTTTGCGTCGTCCGGCTACGATTGTCCTAACTACATGAACCCGGCCGAGTACTTCATCAGCCTCGTGAACAC
GGACTTCGACGACCACGCGGACGTGCCCAAGCTCGTGCAGGCCTACGCCCAGAGCGAGACCCGCAAGGAGCTGAGCACGCGCATCGAGAGCGACCGCAAG
ACGCTGCAGCACCTGCCGGACATCGAGCAGCCGTCGCCCTCGTCTCTGCGGCAGTTCAAGGTGCTCATGTACCGCAACACGCTCAACAACATCCGCAACC
CGGGCATCTACTGGATCCGCCTCTTCATGTACTTCTGCCTGAGCTTCATGGTGGGGACCATGTACCTGAGCACGAACAACGAGCTGACGGAGGAGGACCT
GGTGCCGCTGCTGTTCTACGTGCAGGCGTTCCTGGTGTTCATGTCGGTGGCCGTGCTGCCCTTCTTCATCGAGCAGCGCGCCGTGTTCGCTCGCGAGCGC
GCCAACAGCTCGCTGAGCGTCGTGCGCTACGTGTGCGCCAACTTCCTGGCGACGCTGCCGGGCATCTTCGTGATCGCGGTCATGTCGACGGCGCTGGTGG
TGCTGCTGGCGGGACTGAACGCGTTCGAGTACTTCCTGCTCAACCTCTTCCTGTCGCTCGTCGTGTCCGAGTCCATGATGCACGTGATCGGGTCTGCGGT
GCCGCACTACATCATCGGCATCGCGTTGGGTGCGGGCGTGTTCGGCATGTTCATGCTGTGCGAGGGCTTCATGGTGCCTCGCGCCTCCATCCCGGACTAC
TGGATCTGGGGCTACTACCTGGCGTTCCACTCGTACTCGTTCGAGTCTTTCGTGTTCAAGCAGTTCGAGAACGAGACGTCGGACGCTGCGAAGGCCATTC
TGGTCAAGTACGGCATGGAGGACGTGGACGTCATGCAGGACATGCTGTATCTTGCAGCCTACATCGTGGGCTTCCAGATCATTTTCATGTTTATCCTATG
GAAGTTCCACACAGGCCGCCGGTGAG