Description :
From Genome Similarity Track
Location :
Scaffold_54:80508- 87533
Transcript NameFunction/comments
Physo_137435hypothetical protein
Physo_159304PsAvh348
Physo_137436hypothetical protein
Physo_157599predicted protein

Sequence
7025 bases(100 bases per row)
CAAGCAGTAGATCCGAAACGCGGCCAGTGCATGAACGATGGCTAACAACTCCTGTTGTTGCGTTGGGTAGTTGAGCTCCGCAGACTTCATCTTCCGACTG
GTGTACGCAATGGGACGCTCGACACCATCGACGACTTGAAACAGCACTCCACCTACGGCGAACTTGCTCGCGTCCGTCCGCAGATGCATTGGCTGGCTGA
AGTCCGGGAGATGCAGCACTGGTGGGTTACACAACCTCCGCTTCAACTCCTTAAAATTCCTCAACTGCACGTCGCTGAAGTGAAGCTTCGCGTTGCGCTT
GATCTTCTTCTTCAGGAGGGCGAACATGGTTGCCGTGACCGAAGCGTATTTCGGGCAAAAGCGTTGCACGTAGCCAGTCAGACCCAGGAAGCTGTGAAGC
TCCTCTTGGGTCCGCGGCACGGGCCAGTCTTTGATGGTCTGCACCTTGTCGGTGTCCATCCGAACTCCGTTACGTCCCACGAAATCACCAAGGCATGGAA
TCTCGTCGGTGCAGAAGACACACTTGGACAGTTTGACGTACAGCTTGTTGTCGCGCAAGATATCCAACGTCCGTGCAGCGCCTCCAAATGGTTTTCGATC
TTCGGTGACTTGATGAAGATGTAGATGTCATCGTAGAACGACTTCGTGTTCTTCAAGTCTCGGAACAGCTTCGAAGTCAACCGGTGCATTGTTGCTGGCG
CGTTGCAGACTCCCATCGGAAGTACAAGATACTCCCACAGTCCGTTTGGCGCCTGGAAAGCTGTGAACTTGATGTCTTCCTCCCGCATACGCACTTGGTA
ATACGCGGACATCAGATCCATAGTGGAGAACCAGTACGCTCCAGACATGGCGTCCAAGATGTCTTCCTTCCTCGTCATCGGGATGCTCTGGCGCACAGTG
TTTGAATTGAGATACCGGTAGTCGTGAACGATTCTCCATCCGACTGGTTTCCGGACACAGAATGTCGGTGCTGCGTGAGTACTGATGCTTGGTCGGATGA
GCTTCTTCTTCACCATGTCTTCGACCCAACGCACGATCTCACGCTGCTGCTCAGGAGACTGTCGCCACTGTTGTCGGTACATCGCCAGATTTGGATCCTT
CACATCAATCCGGTGCTCAATGTCGCGCTTCTCTGGTAAACCTTCGGGTAGCTCAGGACGGAACACGTTGTCCTTGTACTCCGTTAGGAGGTCGAAGGCT
GGATTTTCACGGAAACTGTCCCAGTCCGTTTCCAGATAGCGATGTGCTTTCGCACTACCAACATTGTCGGGTTGGTCTCGTCGTTGCAGTGAGCGTGCAG
CTTGCTTGATCGTCTCGTTCGAGAGCACCAACATGAAGTCAGGCTCGTCGCTCGTCTTGGTCTTAATTCTCAGGAACTTCCGCAGTTTCTTGCGGGTGAT
GTACTTGGTCTGCACACCACTATCGTCGACAACACCCATCGTGAACATCTTCTCCACGACGTTGTCTCCACCCCTGGTACTGCTTCTTTCGTCGGCTTCT
CGTGCAGTACTCTCGCGTTCTGACGTCGCAACGTCGTCTTCTCCAGCTGAACACTCGCCAGCTTGCGGGTCATCTCCTCGTCGTCTGCTGACAACGGTCG
GGGTCTCCTTCTGCACTGCGTCGCGAACAGCTTCGCACGTGGACTTCACATCCGTTTCCAGTGCGGCGCCTCGACAGGAATCGGGTCTTTTCGCCGAAAG
GCCTTTCGCCTCGACAGTTCTCCGAAGCCCGGAGGCAATCACCGGTCCGCCTTCCTCGATCGGTCCACAGGTGTCACTTGTCCGCTCCCAGCGCAGAGTC
CTCGTTCTCGTTCCTTCGATTCATCGACCTCTCCAGTCAATACGTGGTTGCATGTCTTCGAAGAATGGTATTCCAAGAATGCAATCGAATTCGTCTGGAA
TCGGGTAGACGACTGCCACACACTTGTAGGCGTCGTCCAGCCTCGAGACCAGAATCTCTATCGGCAGAACTTCAAGCTCCGCCTCGACAATTTGGTTGTC
TCCCAGCTTGACACGAATGTTCTTGTCGCTGAACTTGGTTGTCTGAAGCTGGTGCTCCTCGACCCAACGCTTGGATACGTAGATCGTGGTGGCTCCACAG
TCCAACAACATGCTTCGTGTCGCGAGACACCTGTCACCAACACTGATTTCACCTGTTACGGAGAACAGTGGACGTGACTTGTAGACCAGGGGGTTTTCGC
ACAGAACGTTCAAGCTGATATTCTCAATCTTTGGTGTTTTGGTTACGCTCTCAGCCACGACAGGACCCTCCTTCGCTGACGTGGTTGCCCGTTTCCCTGT
TTCTCCTGGTCTTTCTTCCTGAGAAAGCAGTTGGTCTTGATGTGACCAGGCTTCTTGCAGTGAAAGCAGGTACGACCCTCGGCGCGTTTGGGCTCAGCTC
TCGGCTTGAAGCGGCCTTTCCCGCGGAACGGCTTCCCCTTGAAGGGTTTACCTTGGGCGTGAGGTTGATCAGCCGACGAGAACTTCTTGTCGCGCTTGGG
TTGACGGTCGCGAGCTTCTTCGACGAAGTGAGTCACCTCGTACTTGACAGCCAAGTCCATAGCGTCGCTCAGGGTCTGGGGGTTCTCGAGCTTGACGTAT
CTGCGCGTGCGAGGCTTGAGACCGTTCGCGTAGTACAGCACTTGGTCGAGTACGCTCATGCCCTCCACTCTGAAGATGAGAGCTGAGTACTCACCGTTGT
ACGTCTCAATGTCTGCTACCTGCTTGAGTCGCTGAAGCTTCTCGCGCAGGACAGCCTGGTAGTTCGATGCCTCGAAGTGTTGGAGCACATGCTCACGGAA
AATCCCCCACGTGTGCTCCTCGCTTCATGTCGTCGACGACCAGTGCAGGAACCAACCGGAGGCAGGCTTCTCCATCGCCGACCCCGCGATTCCTGGTAGT
CGGGTGCTTGCGTCTTCGATCGGGATGTTGTTGATTCGACAGGCGTTCTCGATCTGGAACAGCCATTCGCGGACATCCTCCCCTCGCTTGCCGGTGAACT
TCGGCAGGTTGCTCGGCACTCGCGTGCGGTCCGCCATCGCTTGGTTCAGCCGATCGATCTCGGCGCGTAGTTGGGCGATGGTGGGCATGGGTTTCTTGTG
GTCAAGTTGCTGGGGTCAACAAGTGCTACCAGTTTGACAGGAAGAAGTGCTGTCTTGGGGGAGGGCGTGCGAAACTAAGAGTGCCGCCCCCGCAGTTCAG
GCGGATGGAAGCTTCGCGAAGCCTCCACAGCCGCCCTACATCTGCATATCTATTTTAACTTGGTTTCATTATACCTACGGTGAGTCGTACCTACACTGAC
CTCCTATTGGCTTACCTTTCTACCAATCAGATACAGAATGACTGTGATGAGCAGAATTCTCAGTTCTTTTTCGTTTAATTCTTCACGAGTTTATTACATG
TGTCACATATATGCAAGTACCGTCATTATGAGCATGTTACCGTGTTGGATGTGGCACTGCCCCTTTTCCCCAATCCTGGCCCCCAGACCCGAATGTTGGC
TAGATCCGCCCCTGACGCGACCCACCACTAGTATAACAAAAGCTACAAACGCACCGTCTAAGGTTACAAAATGTTAGCCACCTCATTTGACACTAACTAA
GAGTTTGCAAACGAACCCTTGATGTTCTGTGAAGAGGTGACTGGTTCGGATTCCTCAATTTTTTTCCAGACATGTTTTTGCGGAATACGAAAGTTGGATG
CTATGTTCAAGCCACCGGCTTCAAAACAACTTCTCTGTACATGCAGTACTTCTAGAAAATGATGTGTCACTAAATACGAATCACGAGAAGGGCAAGTCAA
GTTACAAACCATACTTTTGCTTTTTCGGAGAAGAAAAAGAAGCCTCGGTAGTACATTGTACTACACAGCAACTCCGCCTCTGACAGATTGCGCTGTTGAG
TAGACCTGTTTAGTGCAGTGCACGAAAAAGTCCCTACAAATGCACTAAAGTACTTTAGTGCACTTTTGGCGCACCTGCGCACAACTGATGCTGGACATTA
GCGTGTGCACTAAAGTACTTTAGTGCATTTGTGGGGACTTTCGTGCACTGCACTAAACAGGTCTACTGTTGAGCTGAAGCGTTGGTAACTCACTTTGGAA
AAGTCAATGTGATGCCGTAGCGTGCAGATGTACTGTACTGCAATGTGGTAGTCACCATCGTAGTCACCATCATAGTCACCATCATCTGCAGGATTTATGG
TAAACACGAACGAATGGACAACACAAAATGCGACGGGAGGATACAGTGCTGGGGGCGCCCCAGCTGGGCAGGACGATCAGGAAAAGCCCTCCCTCCTCAC
ATGGCCATGTGCACTTTGATTCTCACCCAGGAGCCCCAAGTCGAGCGAATGAGTTTGCTCAACGCTGCTTTGTTTGCGATCTACCTTCTTAGTGCGCTGG
GTTGCGATGCTTCAGCCCTCACGAATTATCCGGACCAAGGGAGGATCTCTCTCCCCAACCTACGCCACTCCAACACTGCTCTCCAGAGAAGAGTGTTAAA
GTCCAAGGACGCGGACAACGTCGACACCAAGGGCGACATCGAGAGGGCTTACATCCCGGGGTTATCACCGATAGCAGGGGCGGTCTCGAAGATTAGTCCG
TCTGCTCAGAAACTCGCTAACAAGTTGTGGCTGCAGTCGAAGACGGACCCAGAGCTGGTTTTCAACGTGTTGCACCTCGGAGAGGCCGCCGCGAAGCTCG
ACAACAACCCAAGGTTCCTCCTGTGGCTCAAGTACGTCGACATGTACGCGAATTTAAAGTTCCGCTCGTTTTCCGACCACCAAATCGTTGTGTTGCTGCG
AAAGTCCCACTCGGACGAGAAGCTGGTGACACTTTCCCAGTCGCTTCGCCGAATCCCGGCCAGAAAGAACTTGGCTGAGATGATGCAGCGTTACCTGATT
GAAGACTCGGCATCGTCGCGCCCGCTGCTGATTGCGGCGTGGCGTGAGTCTCTTGAAACACCGGATGAGGTTTTCAAGATACTATATCCAAATGGGGCGA
CACTTCCAGCGGACAAACTGCCAGACAACTCCCAGTTCCTGCAGTGGTTTAAATACACCGAGACGTACTGGCCAGTTGACACGCGCGACTTGAGCACGTT
CAAGTTCTTGGAGCAGAAGTTTGGCGATTCGGACATGCACATCGCGCTACTCTTCCAAGCCGTAAAGCAGCGTCAGGAACTCGAGACCCTTGGAGATAGC
TTGCAGAGTCTCCTGTTCAATACTTGGGTAGACAAAAAGTTCACGCCTGGGTTTGTCCAGAGTCAGTTGGCGCTGCCGTGGGGGATTGCGATTTTCAAGT
TAGGCAAGGGTGACGTCTTTTACAGAGCGCTGGAAGAGTACACGATCCACTATACAGGAAAACTGGGTGGAAAGGAAGTGCTGAAGACAGTGCGAGGGTT
GTTTGCCAACGATAAGCCTGACGAAGCTCTTGCAATTGCTACAAACCTTGCACGGAACCAATAAAAGGTGTCTTCCTGTCGGCGACAACTTTGACAATCC
AGATATTCGTTTGTTTTATTTAGCGGAGTCACGTCGTATCGGTTAATAGTCCTTCTCTGGATCAGCCTCATGCTGGTGCCTCGAAGTGATTCGAACAGCG
ACCACCATAGCTACTCACTCAATTGAAATTGGTGTTTGTTTCGAACCAGCTTGTGAATCTGATTCTGTTTGCCTTGCCTTCTTCTTCCCACTCCCCTCTG
CAGTAGCACTCTTTTCGTCTTCTTCACGAATCGTGAAGGTGCTGAGCAGTCCAAAGTGGTCGGATGGCCACAGTCCATCGGCGATCTTCTGCTGACCGAC
AATCATGATCTCATCAAACGTACACCGCGCTGCTTCTTCACCGGGCGCAGCGTAGAAATACATGCGATCCAGCCGACTGAGAAAGGATCGACTCGTCACC
AGCGTATTGCGCGTACCGTCAAACGTGTACCCATTCTCCTCCGTGTTACCAGGCACAGACAACCAGAGATCCTTCCAGCCTCCGGGAAGACCAGCCGTCG
CCTGCATCACAACAAGAAAAATAAATTGGCTCGCCTTATCAACAAGAATCTCGACTCCAGATATCCTACCATGTCCATTTCCTCTTCGTCTCCGTGCCCC
ACCTCCTCCCCACGAAGCTCACCCGCCTTCCGTCTCACCAACTGCTTCTCATCATCCGTAGTATCCGCTGCCTCTAGGAAACAATCCTCATGGAACCACA
CTCGGATCTCCATGACCTTCCCTCCGGCCACCTTGTCCTTCATCATCTTCCCCACCCGCACCGCACCCTTATCAATACTCTCCCTGCACTTCCGACACTT
GGACCTGCCACTCTTGGCCAGCTCCACATCCACATCCGCGAACGCGGTCAGACGTCGGTCCAGCAGCTTCATGTCCGCTCGCAGCAGGTTCGTGTCCCCC
ATGAACACCGCCCCGAGACAGACGCTGGGACTACTCTGGCCATGGAGTTGTCGTTTCCCGCCTACTACCACCACGTCGTCACTCTCCGCATTGTTCACTC
GGTCCCGAAGTAGAGTGAGACTCTCCTTCAATTGGGCCACGCGAGGCCCCGCGAACTGCGGGAGACTCTCGAGGTGGGACGTCCCCACGTAGAGCGTACA
GCCCGGAGTGGGTTCTACCTGCATGAGCACGAGCTCTCTGCCCATCCCCGTATTGGAGAACGGGTGCGTCTCTAACGACTTGACGGGGAGGGCGCTGAAT
AGGGCCACGAAGTAGGCCTCCTGGAAGGGCGGGGCCGTGTCCACGCTGCAGTCGTAGAACTGGGCCCAGCTCTGCGCCTTGAGCAGCGCCAGCGCCTCGC
GCGTGACCTCCTGGAACCCGATGACCGCGGGGCGCGTGCGCTCCACGAGCCGGCCGATGGCCTTCATGCGCACGGAGCGAGCCACCTCGTCGAAGAAGAC
GTTGAACGTCAGGATGCGCAGCTTCATGCTAGCTGGCTTGTCAAATGATTCTGTGGTTTTTGAATTTTCTAAAGTTCGCGGATATGCGAACTTAAAGCCC
GTTCTCAACCGGACCGCTCTTATTG