Description :
From Genome Similarity Track
Location :
Scaffold_552:8050- 9065
Sequence
1015 bases(100 bases per row)
tgaaggaaGgAGCTGccGccGcGTTCGCGGGTTGCATGGGTACGATCATCGCCGATATCTGTGGTGTCTACATCCTCGTGGCGGCCATGGACGGCCACCC
CAGTGTGCCAAAGCCAGACGTGAGCCTCGAACAGGTCGCTACCACGTTCGGTAACCTTGCTCTTGCCTACGGTGGTGCCGTTGTCATTCCTACCATCCAG
CGTCAGCACAAGCAGCCAGACCGTGTGCCACAGGTCGTTGGTATCACGCTCACCTTCGTCACCTTCCTTTTCGTGGCCATTGCCGCCACTGGTTACTCGG
CTGTGGGATGCCAAATCTCGGGCAACCTCTTGTTCAGTGTGTTCCCAGATGAGAATGGATACGCGGCCATTGGCTTCAAGTCCAAGTGGGGTCCAGCAAC
GCTTGCCTACCTGTTCATGCAGCTGCACGTGACGATCGCTTTCGCTGTCTTCCTCCACCCTGCTTTCTACATCATGGAGCGTCTTTTCCTCGGAATGCAC
CGTGTCCAGGACGAAGCTGCCGAGGCTCTTCCATACCGTGCCAGCGAGACTCCACAGGAGATCTACAAGCGTTCGTCCAGCGCTGCTTGGAGTGTGCACT
CGAACAAGCTCCTCGATGGTGCTGAcGTTGAGAACGATGAAGGAGATGTTGAgCTTGCTGAGTACAAGGGTGCTGGCGCGAtGCTCAAGTACGTTgCCCT
TCGTCTTGCTCTCATCACCGGCCTCGTGATTCTCGCTGTCGTGCTCCGTCATAAGTTCGTGGACCTCTCGGACTTCATTGGTGCCTTCTGTAACACCATC
CTGTGCATCCTCATCCCGATCGCCTTCTACCTCAAGAAGTTCGGTGCCTCGCTGCCAATCTGGGAGCGTGCCATCGCTGTCTTCACGTTtATTGTCTGTG
CCGTGCTCGGTGCCTACGTGAGCTACAAGAGTGGCAAGGCCGTGATCCTCGACGAGACTGCCAGTGTCAAGTTCCCATTCTGTGAGGCGGAGCACCAGAA
CGTTCTTTACTACAT