Description :
From Genome Similarity Track
Location :
Scaffold_1112:805- 3346
Transcript NameFunction/comments
Phyke_g11538hypothetical protein PHYSODRAFT_426370
Phyke_g11539hypothetical protein

Sequence
2541 bases(100 bases per row)
ctgctagTGCATCACTCAGCCATGCAGTACTTCCGCCAGGCGAAGAATTGGCTTCTGGGCCAGGTTCCGCAGTATCGCGCCGCTGTTGATGCGCGCCTGC
TCGGGGGAGAGTCAGACACTGCTTGAAGCGCGAGTCTGGGGGCTTTGTCAATAAAGCTCCAGCATGTACGAAGCAGGCACTCAAGCAAATGGTCATGCAT
TTGTATTCTACTGCTTCCACGACGGCTGGTTATCAAGATGCGGCGCTACTATGCCTGCTTTGGTTCCTTTTTGGCCGAGCATCAGATTTAACGCTGCTTC
GCAAGTCTAACTTATCCATCGGCTCAGGTGACAACTTCTTTGTAATATTCATCTGGACCAAGACGGCCGAAGAGTAAAGACTCTCTCTTTTCCCTGACGG
CGACTTCGTAATCTGTCCGATACTTGCTATTACGCTCGCATTGATCACCCAGTCGTCACCGACGTCCGCTCTACTGATCCATCTTCCGGATCAGTAGCTG
CTTACATCCGCCACGTTCACACCATCCTTCCCGCTAATTGACCTGCTAGATCATCCAGAAGCAATGTCATTGGCACAATCTATGCCCGACACTTCGATTT
CCAAGGCCCCAATGACCACGCCTGGTGTCCACAGCTACGTCAATCGTGTTCTTGAGCGAATTGCGAAGAAGTCTGGGGGTAACCGAGCACCTCACGTCAC
ACTCTTTTCGCCGTGGTGGCGCGCAGCACGCCAACAGAGCGGGTCTCAGCGTCCAGTGGATTTTTGATCGCAGCACTTGGAATATGACGGCAACGAACAA
GGCCTTCGCGTATGTCTTCAACACTCCAAGTGAGGACCACCAAGTTTCGAAGGTCTTAATCAGCCATGCTCCCGCTAAAACGGTGTCGCTTCTTTCGCTG
GAAATATTTGATTCACACACAGAGACGAAGATTCGGGCGGTTGCAACTGCACTCTTTTACTCCTGTTCAGGTCTTCAAACATCACAATATAACGTGAGCA
CGCGAGTGATGGAAACCCTCACGGCGTACCTAATCCTGCATTATCCGTCGATGAAGCGCGTCAACCGTGGGGGACCTGCACTGGAGAGACTAGAACTCTG
TATCATCGAGTGTGGTTACGCTATTACAGAGCTGCTGGCTTGGTCGTCTCACATCATCTATAGTAGCAACGCGAAGGAGAAAGACACAACGCATCAAGAT
ACCACTACAACCATAATGGAGTAGCCAATATTTCAGCGTCAAACAGCCTTGATTGAGCAGTTAATCCAGGTAAATCAACGTCTCGATGGTCGTCTGGCTA
TCATGGAAGCTAAAGTCGACAACGCAGTACACGACACACAAGTAGCAAACAAAAATGGTGAgaacacaagcagcaatgatcCCCTGGCAGAGAGATTACG
TGCATCAGAAACAACAAGCCTGAGAGATGCGTGGTTCAGCTGGTACGCGCAAGAGCCTCGCATGTGGAGCTCGAAAGAGAGAGTAGCCAAACACGTGAGG
TCTAACACTAAATGGGTTGTGGGTTTCTTGAAGCTCTCCCTCAGAGATGGCTTCCTGCTCGATGTCAAATCTCCACGTTACCGCGACGATGTACTTGAAC
TTGGCTCCATTGCTAAGAAAGAGCTGTTGACGTTTCTCCTGAAACACAAGACAATAGCTAGAGACAGCCACAACGTCCTGAAGCATATGCGCACACTTCA
CAAGTCAGGGGTCCTCAACGAACGCACCTcccattttcagcagctccgatcCGCAGGACGCATCACTGACTCTTCCCCACCTCATACTCACAACATCATA
TCTTCAGTCCTTTCGGTATAAGTCAATACATATCGTGCCTTGTGCATCTTGTGATAGTTTACCGAGCGCTATTGATTTCTCTCTCAGCAAATCACTTCTC
CTTTTACGCCCAAGAAACCACAACCTTTGCATCACCATGCTGACCAACAAGCCGTCCAAGAACTCTATTAGCTCCAGTAAGGTGTTCAAGACCTTGTGCA
TCAAGACAGTCAAACGGTTCGGAGGATTTTGAGTCAATGATGAGGCAATTCGTCACCTTCGACTTATCATGGTGCTCTCTATTGAGTTAGTTGAGGTTCT
TCCCGTCATCTTCGCTTCCCTCAcagagaaaaagaagcgcaagatcaTCCTGGACTATGTCTGCGAGTGGCTTCAGCCTGCTGTCTCAGACCTGTGCTCC
AACAAAGTCATCGCTgtcggagacgctgctgaaggtgctgcgGACAAAGATGACGAACAGGAGTGGAGCACCGATACCAACACTGAAGCCCAGCCGCTGT
ACTTCGTCCACCGACTTCTCGACAGCAAACGAGAGGGGCGCAAGATGGACTGGGAACTGCCTTGGGAGCCGTACAAGAACctgccgatgatgatgattGC
TCGCTTTCGTAAAGAACACAGAGCCCTTGTTCGTCGAACCTACATCGAACACTAGGCAACGGAAGACAACTTACTAAACAGGACAGAGGGATAATACATA
GGAGTAGATTTGGGCTGTAATATACCTTCTATTacaagatc