Description :
From Genome Similarity Track
Location :
Scaffold_210:8049- 15000
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_210-snap-gene-0.30Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_210-snap-gene-0.21Flagellar radial spoke protein
Pytul_var.sporangiiferummaker-pug3_contig_210-fgenesh-gene-0.8Conserved gene of unknown function

Sequence
6951 bases(100 bases per row)
GCACTCACCTTTTGCGCTTGAACTGCTGGTTGTTATTGTGGCCTCGGCCTCCTCGCTGCTGGTTGAACTGATGATGCCCGTGGCTCCCGTAGTGACTGGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGCCGCCGCCATTGCTTTGTCGATGGT
GGTAGCTTTTCGGCTGCGAGCCGAACTGCATCGGAAGCTCACTGCGGAGATCCTGGTGCGCTGCTGCCTGCTGCTGCTGGATCATCGCCTGCAAGTGCGG
TGGCAGCTGGGGCAGCGCACTGCTATGCACTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGTTGACAAACAATGCAATTCACCGTTGCACGCCCAAATTAGTGTACACCACACTACATCCCTTCTGT
TCCTTTCAATAAAACCTTGTGAAAAAGTGGATGGTTGGGCTTCGCTTTCCCGAGGTTTTATGTGTCTATTAGTGTGGTTGGTTGGCTCGGATCTGTCTGC
TCTGTGTATTTATTATTAGTGGATCGCTTCACACAGAGGGAAGCGCGAAAGAAAGCAGGCAACTCACGAGCGCCATTCGCTTCTCGCTGCCGTCGTCGCG
CACGCGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGAGAGAGAGAGCGACTCGCGTAAGAGTACGTCTTTT
GTGAAATCTGTTCTGCACCGTGCTCACTGGGGAGCGTTCAAACGGTCAAGACTCGAATAGAAGCAGAAGAGAAGACGCGATCGAGCTCCGAGGCGGCCAT
CACGAGAGAGAAACCCACCCTTTCCTCTTGNNNNNNNNNNCCGAACGCGGTTGTTTGATCGGACTATTGTTGTTGTGTGTTGTGATCGTAGTGCGGACGA
CGCCCAGCGCTTGTTTCTGGCTTTGGTTGGAGAAACCATGAGCTTTTCGTCCGGTGCGCCGNNNNNNNNNNAAGGCACTGAGAAGGTGGAGTACCGTGTG
TGGAACCCATTCCGCTCGAAGATCGCTGCTGCCATCCTGGGTGGCGTTNNNNNNNNNNCAACATCCACATCAAGCCAGGGGCTAAGGTATTGTACCTCGG
TGGCGCGTCGGGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACCAAGCGCGTATTGTTGCATTGAACGCTAGTTACTTTTTGC
GAAACGGCGGTCACTTCGTAATTTCCATCAAGGCGAGTTGTATCGATTCTACTGCACCAGCTGAGGCGGTCTTCGCCCGTGAAGNNNNNNNNNNNNAGCT
GCAGCAAGAACAATTCAAACCTGCGGAACAACTCACCTTGGAGCCTTACGAACGTGATCANNNNNNNNNNNNNNNNNNNNNNNTGGTTGTTGGATCGTAC
CGCGCCCCGAAGAAGGACAAGAAGTAAACCAGTTTTGCTTTGTCTTGTCCTTGCTTGCAAACAAAACGGGAGCCATATCAATAGAAAAAACGAATGCGTG
TCTCTTGCATGTGGCACAAAAGCAGGGCCTTGGACGTCGCGAGTCGACTGATCGGCCGCGCGAGTGCATGTGGCCCGTAATTGCACCCAGTGATCTAATT
TATGCCCACTTGACGCCTCTAACCGCTTATCTTCCTCGTCTCTTGTAGGTCCTCGCCCACAATTCCCCCTCCCACCCACCAAGTAGCGTAGTAGTCGAGT
CAACTAATCCATCGTGTGCGTGGGTCTGTGCTTGTTTCCAGCCTCGACTCTTTCTCTCTCGTTGGTCAATTTTCTCGATGATTAAAAACTATGCGTCGGG
CGGACTGAACAAAAACACCATCCCGCAGAAATGTTGGTGGTGCCGTGCTGAGAAGACGTCTTGAGCCCTCCCACGGGAGGTGCATGAGAGAAAAATGGCA
CGAGAGAGAGAGAGGAGAAAGTGGATGGGTCCATACAAAAGGCACGCGCTGTCTGACGGTCGTAGTTGATAGCTTGAAATGTTTGTTTTCCACGTGGGCG
GGGATCCGTCTTCTTTTTTCTCTTAGTCTTCACATCCAAATAGCAAAAATATATAATACGCACTTGTAGCATTTATTCAATCTTCAGTTGATGTTGTTTT
TTTCAATCGTGAATGTGGGAAGCTGGTGCAGAAATACCTCGCCGTTGGGTTGGTTTCCACGAATAGCTTCACTCTTGTGCTGCCAACTTCAGGGTCAGTC
TTCAACATCAACACATTCTTCACCTCGTGATCTTGAATTGCTGCAATGCATCGCGTCAGGTACTTACCCATAGCCCTTGTGCATGTTTGCTTGTGATCAT
GAATGATGGCATTGAAAACCATTCTCTGCAGTGACCAGCTTCGTGATCGACACCCATACCTGGATCTGCCGTTCCAAGAGTCGTACAATTCAAAAGAGGT
AACCTGCAGACAGCAAGCACATTGAGGCCGTTTACCCACCATTCAGATCAAACTAATGAAAAGTATGCTTCTGTCGTCTTCCATGTGACGCTCATCGAAG
GTCTCTCGAGCGTTTGGCGCGCGAGCCGTGCCCAAGTATGCTGAGCTGCTGGTAATGGACGATCTCAGCGACGAAGACCGTGTCAAGACGCTCCAGGAGC
TCTTCGAACTCCTGAGCAACCAGGTCTGAAAGCCTCGTACCGAGGTTTCCCTTGCACATGCTATAGACACTTGACGTGTGCGCTTGGAAATTGGATTTTC
AGGAAACCAAATGCACGGCTGGAACTCACGAGATCCTGTTTTCCTGCGCTGATCTGGGGGAGACGTCTCGATCGAGCGCTGTGCGCATGCACGCCGCACT
CGTGATCTCAGCGCTCGTCCTCTACGAAAATGTGCGGCTTTGTGCTTGGTTAGTCCTTCATTTTCTGGATCTGATCTCGATTTTTTCTTCTACGTCGCAG
GACAAACCTGATGAACTGGGCACGGAGACCATGTTGCGCGCTGCGATCACGCTGTTGAGCGACGTTGACGAGAGCGTTGTTGCAGCGGCATGTACGATTT
TCCGCAGCGTGTCGCGGTCCAACCAGGGCGCGTTGCTGCTCNNNNNNNNNNNNNNNNNNNNNNNNCGTCTAGTGCTACGGCCATCGAGTCTCTCATGGCC
ATGGTCACGCGGCAGCCTGTAAAGATGATCGCCGAACCAATTCTAAGCGAGCTTCTTGCCGTGCTCGCCAACATTACGCGCGTGTTTCAAGGNNNNNNNN
NNNNNNNNGTGCTGGACATCCTGAAACACGCACGACTGTACCCATCGGAGGTGCTTCTCCATGCCGTGCTCGTAATCAGCAACTTTGCGACCCACGACCA
GGGCAAACGCGACGCGATCGCCAAGAACGCGGTCGAGATCTGCCTCAACGTGCTCACGCGAGTGCTCACGCCGTCGCAGGGCATCAAATGCGAGACCGAA
GCCGCACAGATCGAGCTCACACGATGTGTCGTCGGCGCGATCATGGGACTCTCGACCTACGAGGACGCCAAGCCGCGGGTTCTTGAGTTTGGTGTCGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCATCCACACCCGTCGATCCAGCAAAGTGCTGCGATAGCCGTGAATTCCGTGT
GCGAGTCACCGCTTGGCGCTGCGAGCTTTACGCGGAAGCTGCTCGCGGACAAAGTGCTGTTGGTACGTGTGCTAGGCGTGCAGGCGATCTCAGCACTACA
CCCGAGTTTGTCGGGCAAAGACGAGGACGACAAAGTCTTGGCTTTGGACGTGCTCGTGGATCTGCTATCTGACAATGGAGCCACAGCGGCAGCAGCAGCC
CATAAAGTCGTCCAGTGTCTCGATATGTTGGATACGCTCGTGGAGCTCGTGCTTGACCCGCTACGCGAGATCCACCAGCGCGCGCTGCTCGTGCTGCAGC
AAATGCGCAACAAGGTGCGTATGAAATCCATTTGCTTCCATCACACCCTGCAGGTTTCTTCCAGTGTTGACTATATTGCCTGCATTCAGGGTGGAGACAC
GCTCGCGAAGCGCATTGGCAAGAAATTGCGGAAACACGGTATTCCGGATCCGGATTTTGAAGCGATTGTCGGACTCACCATCACCGATTTCCAACGCCAG
TACGAATAAGAACTGGGGTGGGCTTGGACACAACAGATCACGCAGCCAGACGTAATGCTAGCTTCAGCCTTGAACCACCATCTATTTCCCATAAGAATGA
ACAACGCTTTTCCAGCATTCCCATTTGGACTGCTCGATAATGTCAGCTTGCAGGTACAGGAATGTGCCACGAGCTCTGTCACTCTTGTCCTTTGCAACAG
TGTATCTCATGCCGTTGACTCTCCCACATTTTCACTCTTGCTCGAACCTCTCAAAGCAAATTGGTTCATGCCGAGTTGGCTTCCACAAGCAAAAAATAGA
TCCACTTGAGGCTCTCTCACGGTCTCGGTTCAGGAAAAGAAGAACGCCAGGACGATCGTTGCATCGCTTCCAATCGCGTTCTTCAAACGCTACCCCTCCC
CATTACAGCTATGACGCTCGACAATCTGACGCGCGCACAAGCCGAGTCCAAGCACTTGAAGCTCAAGAACAGCCTCGCGCAGGCAAGCGCCGAGTTTCGT
GAGCAGTTCAAGGACGAGCACGCGCTCTTCCGCAGTCTTCCCGATCGTCCACGATCAGGGTCACTGGCACCATCCCCAACTCCACATGCGAGCCCACATG
ATACTGCTGCCGTTCGCGCGCTCACAAGCGACCTCGTACGGCTTGAGCGAATCAATCAGTGCTGCAAGCGCGTGAGGGTGTGGCGGAGGCAGATCGCCAA
CCCGCTCGTGCAGTACCGTAACCAGCTCCTCTTTGGCAACAAGGCGGGGGTGACCAAGAAGAACGATCGTCGCATGCACATCACGCTGCTCATGTCGCTC
ATCGTCGACGTCTACGAGCAGCGCATGAACTACGAGATCGAGGAAGGCAGCAACAGCACCGCGGGCATCCAGGAGACGTTCCCTGAATTTGTCGTGCGCG
TCATCTCGCAGCGCGCATCGAATCGGCGGAGTGCTGTCGATCAGCTCACGAGCATCATTACCACGGTGCTGCAGACATCGTCCGGTACCCACCTCCGTGT
CTATTTATTTGGCTCGCTTTGTGGTCTCGATGATTCGTTTAACCCTCCGGAGAAGATTAAAGTGTTTCTGCACGTTCTCGAACGACTGCACCGCTGGAAG
GCGCATGCATCAAATGCGGCAGCCGCAGCAGGCTCCAGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCTTTGCAG
ACGGCTCTGCGATGTCGGACGTCGTGTTCCACACCATCGGCATCCCGCAGCATGTCGTGCACAAGGTGGTCGCGGAGCTCTTCCAGGACGATTTCTACTG
GAACTTTCAGTTCTGGCACGCGCAATGCTGTGAACTGCACGTGGTCNNNNNNNNNNGTGGAGGAGCTCCAGGAGCGCGCACTCAACCTGGCCGCGTCATC
GCGAAACGCTCTGCTCAACAGCATGCGCAAGATCGACGGCGACGCGTTCCTCGCGTTGCTCATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCAGCAGACCCAGGACGCGCGCGCCAATGTGCTCCCACTGGCGCCATCTGAGACCGCGATCTTTGAGCTGCTGGTGGACGAGTTCTGGAACGCCGAC
GTGCCCTGGACGAGCGCCAAGGTGCGGACGAAGCTCGCGCCCGTTGCGCACCTGCGGCCGCTGCACGAGCTCGAGGCGCTCTACGTGGACTATGTGCGCG
ATTTGGACGAGTCGCGGAAGTGCTGGTCCTGGCAGACCAACTGGCGCTGGGAGGCCGACTGGGAGTGGGGCGTGCTCCATATTCAAGAGGACAATGACGA
TGCGGCATGATCGAGGAAACGCAGTTTTGATGCATTTGAACCAATAAAGCATCTATAATTGTGAATTATAGCCAATAGGATGCGTCTGGTGCCGAAAGTA
TCTTCGTGTGCAGGCAGGCATTTAAACTGTGACTGTAGGAAAATGCCCAATGGATCTTCGTGCACACACTCTACGATAGCGCTGGCACGCCTTTGTTGAA
GTGGCTTTTCATTCTGATTGTCCAAATGCGTACAAAGTATACAAACTCGAAGTATAAACGGAAGCCTGTTTTGCAGACAGTCTGTTGCTTGGTTGGTTGC
AAATCGCGGGAGTCTCATTTGGAATCCGCTGCCGTCACACCATCACATCATCACCCAGACGACTCATTACGATAGTGGGTTTTAGGATGGCGGTCATGGG
CGAAATGACTCACTACTATTCGCGCGCATGCAGTTGTTGGCATGTTTGGGTGCTGCACAATTCCGTTCTTACAATCGACTGTTGTATGGACCAAATGCAG
CTGTTGCTACGCTTGTGGCGGAATGGCACGTTTCCATTTTGCCACACGAAA