Description :
From Genome Similarity Track
Location :
Scaffold_253:8049- 10353
Sequence
2304 bases(100 bases per row)
TTACCTCCCGATAGGGGCGTACGTCATAAAATTGACTTGGTTCCTGGAACAAATACTGCGTTACACGGTAGTGGCATTTGCCAAAGGAACAATGTGAAGT
CATTGAAGAGTTTTTCACTGCTAAGCACGCGGTGGGGACGGTACGTCAGAGCAAGTCTCCTCATTCCACACCGACATTTTGTGTCAAAAAGCCCAATGGT
AAGTGGTTTATTGTACATGCTTATAATAGGATGAATGCGGCCACTATACCGGCACAAACACCAATTCCTAGAAATGATGTTCTTCAGAACAACATAGCAG
GATGTACTATGTACAGTGCACTCGACCTGGTTGAAGTATAGTATCAAATGCTCATGCGAGCAAGCGATATCCCGCTCACAGTGGTTAGTGCTCCAATAGT
TATGATTTGGGAGTGGCTGGTTATGCCCCAGGGCCTTTCCAATGCCCCGGCTGCATTTAATCGTCTGGTGACGCAACTTTATGCACAAAAACGTGTTTTT
ATGACATAGTTGGTTATAGCCGAGCGGAACAGGGTCGATCGGACGTGGATAAATACATCGACCATTTACGAGCTGTGCTCGAGTGCATGCGCACCAACGA
GCTGTACGCTTATGCATCAAAATACATCTCTGGTGCCAACCAGATCCCAATTTTAGAATGCTTTATTGAGAATTAAAGTCCTCGGGCGGATCCCGCAAAG
TTGAAGGCCATACTGGATTGGCCAGTCCCAAATAACCAACAGGATTGCGCAAGTGGCTTGGCATTTCTAATTACTTGCACAAGTATAGCGATAACTACGC
GGATATGACTTGGCCATTGTCCAATCTCCTTAAAAAGGATGTGGGGTGGTGCTGGACTAGCACCACAAAGGATGCTTTTAATGCCATAAAGGAGATTCTC
CTACATGCCCCGACTGTGGCTTCGCCAGATCTGGTCGGCCTTTCAGTGTCGTCTGTGACGCTTCTGATTTTTCCATTGGCTGCGCTCTGTTTCAACAGAT
GTTGAGAGACGCGAGCATTTCATCGCTTATGAATCCCGTAAGCTTAAACATGCTGTAAAGAACTATCTAGTTCACGACAAGGAGCTACTTGCTATGGAGT
GTGCCCTAGTCAAATTCAAATTTCATCTGGCTCCAAGCCTTTTGTAGTCTAAACAGATAATGCGTCTTTACGCATGGCGACCCAATCGCCTCACCTCTCG
CAGAGGATGACCCATTGGCTTTCATTCTTTGCAGAATATAACCTCGAGGTGAAGTATAAGCCGGAGAGGCAAAATACTCTGGCTGATGCGTTTCACGCCG
GTCTAACTATGAGCTTGCTCATATTACGATTTTGTCGTCGTCAATTACTAACTTAACCCGTGCATCTTATGCAAAGGATGACCAATGTTTAGCTTTGCTA
CCAGCTCTTATAAGCGATGAGTTCAAGGAATCAGACATTAAATTGTCGGCACGTTTTCGTGCGAGGCTACATCAATATTCTATCGGTAATGGCCTGTTGT
GCTATCGCACGGTTGTTGCAGATACCCCGCGTATCGTTGTTCCTCATGATGAAGAACTGAAGTATTAAATTCTCTGTGAGGTCCACGACACAGCGATTAG
CGATCATCTCGGTCGTGAGAAGACCTACGTCTTAGTCAGCCAGAGTTATTGGGGCCCAAACTCTATATATGAGTAAGCACTTATGTGCGCACATGTGAGA
CGTCCCACCAGGTCACACCCCGGGAGCATGCGGCTACGCCGCTGGCTAGTCTTCCTGTACACTCTGGGTGTTAAGAGTCCATCGGCATGGACTTTGTTTT
TGGCCTACTGAAGGATTCGGGCGGCAACACAGATATTGTGGTCTCTGTTGACCGTTTGAGCAAAATGTCTCAATAAGCGGCTGTGCCGGACCCCATTGAT
GATGAAGGTACGTACAGCTTTGCTGCTCGTTGATCGCGTGTTTCGACAACGCGGTCTGCCACTAGCAATTGTCTCTGACAGAGACCCTCGTTTATCAGGT
AAATTTTGGAAGTCCATCTTTAAGGTGCTCGGCGCCAAATTAGACATATCTACAGCGGCTCACCCGCAGACCGATGGTCGGACTGAGCGCTTTAATTGCG
TCCTGGAAGATGTCGTACGCAGCATGTCTGTTGATACGCCTCGGCCTTGGAGCTCAATGCTCCCCATCGTTGCTTTCACCATGAACAATGCTGTCCATGC
CTCGACAGGCTATACTACGTTCTATGTGAACGGCCTCACACAATCCGCGTTCCATTGACGCTACTAATACGTAGTTCAGGGCTTAGGGGGGAGAGGTGTC
CGAT