Description :
From Genome Similarity Track
Location :
Scaffold_36:80484- 85497
Sequence
5013 bases(100 bases per row)
GACAAAATCCATCCGTATTTTCGTTCCAGTACTTTTCATTATGGCTCGTTTCGCAAGACTTATTGATAGAAAACCTTGAAATATAATTTTATCTTTTCAT
TCCAGCTCTCGTCCAATCCTTCCTTGCTGAGTGCAGTCTCGTCCATCATATTGTTATCGAAAGCATAAGTCATTGCTGGTTTTTAAACTGTCAAATCTTC
TCCAATCCATTCCACAAAAGTCCCAGAAGAATCAATCTTGAAAGACTTGCGCCTGGCCTTCCCGGCGCCCGACTCAGATGAGGATGACCTTGCTAGTATA
CTTTTTCTTCGAAATCTTTTTTGGTACACAACGTGGCATGATCTCATAATTAAAACGTAGTGAGCACTGAACCAATGTCAAAATCAGAGACATTAGTCGT
TCAAGAAAAAGGCAAACCTAGACTGACATGTAATGTGCTCATGTATGCACATGATACACTTAGCTTTTTGTGGGACGTTGCGCTGGTAACGCAGCGCTAC
GTGCAAATTATAGAATCATTGTTTCATCAAGGTCCACTTCATCTTCAACTACAAACAACTTTACATGAAATGGGTGCTGCTTCCAACAGCTTATGTACAT
CCTTTCCTGACTGTGTCGAATGATCTAAGAGTCGTTGTGTTAACAGACCGACCTAAGTGTGGCGATATTTTGATTACAGCTCGCCAAAACTTGACAATAC
TTTAAGAATAGTTCGGCACTCTACAATAAACAATTCACTAGATAGATAATAGGACGTAAACATCAGCGCCTATTCATGCTTATGCTGTCAGCCATGTCAT
TCTCCTTCAATACGTTTTAGTGGCTGGCACATCGTTCATTATTCGCACATTATATTGTGTCTATCAATCTTTGGCCTCTATCGGTATTGATGATCTATTC
GGCACACGCTTTTTCCAACAGCATCGAAACCATTTCGCGTCAAGAAATACAAAGTATATTGTATTTTTCATACATGGGCAAATAAAATATCCAGATAGTA
GATGGCGGCTCACACCTGGATTCCAAAGTTATATCGATAATGCTGATAAACAGTTTCCCAATACGAGTGATAGAGCTGTAAGATATGGTTGCATCACTTT
TTTAGTTTTACCAGTTTTATGTCATGGTATCATGCACACCGAAATGGAATAGACTCTTGCTCTGTTGAGAAAACTATAGAACTCGTCTCAACTGGGAATG
CATAGTTGATACCCTTTCTAATATGCTTTTTTACGGGACCTAGGGACAGGTTTTTAATATAGAGGAAAAGTCATATTTTACCACGAGAATAAAAATGCCC
CGGGTAATGAGAAAATAAAAAGTTTCGCGTCCTATTATTATCATGTAAACGTAGTCACATAGACCGAAATTGTGTTTCGATAAAGGAATCAAGCCGTTAT
AATCACCATTTACCCACAGTATGTTGATACGTCTTACTTCCTAAAACACATGAGTTCGATTGCGATAACATGGATATTAACCGCAACAGATGTACGTACG
CTATGGTTGCGTATCAACTTTACATTATGCCACGACAGATTTGCAACGGGCAAAAGGCTGCAAGCTAGGTTCCATAGAGAAAAAAGGGTCGAACCTAGAG
GGTGTGTAGGTCGTAATCATTCATAAGCGCCATTAATTACTACCCATAAATTTCAACGAATACGTTTAGGAGTTCTGTAGCATATGGTAATAACGCAGCA
CGTGGCGTGGCACCTGATATGACCACTAGAGGACCGCATGCCAAGTGCTGGCTAATACAGAACGACAAACTAATACAAGTCTTGTTTAATCCGTATCGTA
CGCTTCAATGCACGTGTATTGGTTTCTTTAAACTATGATATACATGCTTGATTGAGTCAACACGTCAACCACATCATATATCTTGAGTGTGTTGTCATTA
CCTCTTGAACTCTCCACGCCCGGCGTGCTGTTGTTGAAGTTTAAAGTCATGATCAACACAGATTGATTCCTAGAACAGCACTAACATGTATTTATCAGCA
CTTATAGGGATGTAAATTCGGGTTTGCATAGCCTTGAATAGCACCTTCATATTGTACAATATATATGCACGTGGAAGGTTAATACGGCATACTTTTTGTC
GAATCCAGAGTTAATGAATGACATGTCAGATTCACATATTTACCATGTAAATCCAAAATATCCAAAATATCTGGAAGAAACCGATGATCAACGTTGTCGT
AAAACTAAACGGCAAACAACCCCGATATACTACGCTTGAGGCATCATCGCACCTTGTTCTTCTTGCAATACGCCTGCAGTCGAAGAAGGCTAAGAATTTA
AATTTGATATAATAGGAGCCAAACTGATAGAATGGAAAGATTGATAGTATAGGGTTATATATGGTAAAAAAAGGAAACTAGAACTAATCAGCAGGAATCA
TGTTTTAATCCCTCAACTATAGCAGCAGCACTGTCATAACAACAAAACCACAAAATCTAGCAACACCAAGAACACTAATAGCAGTAGCAACACCAGCAGC
AAAATAACAGCTCGCCAGTACTAACAACAGCAAAAGCCGCAAAGGCAAAATCAACAACAGTAGCATCGGTAACAAAGCAACTTTTCCAATAACATTAGCA
GCAGCAACAAAACCAACACCAGCAGCAGAAGTTGCAAAAGCAACTGGAACAACCCAGATAACCTACAATAACAAAAGCTACAGTAACATCAGTAGCAACA
ACAACGATACCAGCAACAAAACCAGCAGAAACTGAAACAACAAAACAACAAACACTGATAATAACAACATAATCATTAGAAAACTAACAGTAATAAAACA
ATATCAAAATATCATCAACAACAAAAAGAACATCACCATCGTTTGCCTATGTGTACTGCCGCGGTCGACGATATATAGAGTCGTTCACATCTCCCATTTA
CCGTCTATGTCTACAACTGGTGGCTGCATATGCAGCACGCCTGCGATAGAACCTCCTCCACGGCTCCCCATACAGGACCTGGGTTGAGCACTGCCGTTAA
GTTAGTATTAAAAATGACTTAATATGTCAGTATGTGTGTACCACGTCAACTTGAGTATACTCGGACGTGGACCTTTATTTTTTTCCAATTAACGGGGGCA
TTTTTTCTTTTCTTTTTATCAATAGAAATTGGGAAAATGATAAAAATAGGGAATTGCTCAATCTCCGCTTCCTTTTCGATTCTGCCGCCTGCAGGTTTAC
CCGGATATGCTATAATTACCCAAAACTGTACTTACTTAGAAATTACTCGTTTGCTGCTTCCAACATACATATATGTATGTATATATTTGCCAAAATTCAG
TTTCTTACATTTAATCATCGTTTTTATCGTTTCCCTCTATTTTTACGTACGCTCAAGCCGAGACTACATAGTCCTTTCTTTCGTTTAACATTTTTTATCT
TGGTGCTTGTTGTTTTCTTTGCCGTGACTTAGTTAGAGTCTTGCACCGCGATGCTCACGCGTTGTGTCCAGCGCAACGACTTATGCAACAACGTCGAGCA
ACGAGAATCGGCTCAACCGTCAGCTCCACATGCTCCAACTATGAAAGTATTTGCTGCGTCAATCTACAAAGTTGTTGGTTCGTCGACCATAATGGCCGGC
CGCGTGATTAAATTCTTTCCGGTTGAATTACGATTCTTGCTCCCCCATATTTCAAGCTAAACAGACCGTGTAAAATCACATGTCTCTAATTTGGAATGTT
TGATTGCCTTAGTTGCTGAACACGTTACCCAACGACCTCTTCTTCCAAGTCGCTGATACTTAACGAGTCACTACCGGCATCGACGCTATCCAATAGTCAA
CAAGAAGACAGGGATATTTATTCTTTACGCGGGTAAACGTGTCGTCACATCTATTTTTGTAGAATTAAGGAGTTATTGACGGAGAAAATATATTTTACCC
GACACATGGATAGAGACTGCTGCTCACCCTGGTAAGAAACGTCTGGTCGATAGCATGGACGAAGGGGTGTGGTTCTTTTCCTCTTGACCCTAAGCCCTAT
AGTTGACCGCGTTTTTGTAGCTCCTTCTCACGAACTGAAACATATTCGTCCATGTTGGCAACCTTGCGCTTCTACATCGCTTGGTGGCTGTACTCTTGTA
TGTGCTGATGTTGTTCTAACCTCGCGCTTAAGTTTTTCCATACGTCTTCGTTTCCACTAGGCCTAGGCAAGGTAAGGTAAAAGGTTACCATGTAATAGTT
TTTGATCTACCTTTACCTTACCACTACCTTTACCAGGATGGCCTGTGGATACCTACCTTTACATTTGCCCTACTCTACCCTTTTACCTGAATAATTACCG
GGTAAACAAGCGTTTGAATGATAGATGGTATTGGTGGAGTTGCAGCTATTTTGACGATATGACATCACCGGCTTATTAAAATAGATTGGTCGGGTGGAAT
GGCGTAGGATCAAGTTGTGTACACCAGGTGGTAAAGTGAGCGCAATTCACTATTGCAGTACTTCATCAGAACTCATATTGGGCCTTAAATGCCATATCGG
CGAACTGGTTGTGCAACAACTATACAACCCCATCGCCAAGGATATCCTCGTCCCAGTTTTCCTGTTTTATATCGAGCTGCGCGACGACGAACTGCACGTC
AATGGCGCCGGACTGTACGAGTACAGCTAGCGCTTGCGCTCGATTCGCCGCCCTCTTAAGGATATTGGCATCCATTTTATGAGCGCTTGAAACTTCTAGA
AATATGTATATATACTACAATAAAAAAGCACCATTTCAAGCATATAACGAATTGACTACCCATATTTTACATCTCACATAAATGTTCAACACTTACGCGA
CATGTATAAATGGATGGTTTGTAGTTGGCGCCGCGGGTCCCGACGTCAGCGTCGTTTTCGTCGCCAATGCCGTTGTAACCTCCATGAATACATAGGCTTC
GGAATGCAGTCGCACGCAACGCGTGTGCTTAAATTTTCGATGAAACGCTTCATCCGCTCTGAGGGCTCCGTGGCTATGGGGCAACTCACAACTCGCAAAA
TGCTGCACAGAAG