Description :
From Genome Similarity Track
Location :
Scaffold_43:80479- 81988
Transcript NameFunction/comments
Phyta_totarag2022nucleolar protein Nop56

Sequence
1509 bases(100 bases per row)
TttcttcgtgtgcttcttcttcttcttcttgtccgcgTCGGCGGCGGGGGCCTCAACAGCCTCCTCCACgacctgcttgtgcttcttgtccttcttggac
ttcttggacttcttggtaggggcctcctcctcgacctcctccaTCTCAGCATCCTCATCCACAGCGCGCTTCTTAGacttcttgtccttcttggacttct
tgtcTCCCTTAATAGCAGCCTTCTTAAGCTCCTCCGAGACCTCCAGCATCACGTCAGCGTTCTTACGCGGGGCAGCGCCGCTCTCGTAGAAAGCAAGACG
CTCCTCAACCTGTTCGCGCATCTTGTCACCGTACTTCGTCGTGGGCTCGTCAATGAACGAGTCAATACGCGAGGCGATGGCACACTTGTTAGCAAGGTAA
CGCGAGATGCGACCCTTGTTCTTGGCAGCGGCGCGACCAATGAAGGTCGAGTGGAACAGCAGACCGTACTTGGGCGTGTTGCCGCGGGTCTTTAGCGCGC
GGAACAGAGCCTTCTCGGCACCCAGAATCTGCACAGTCGAGGCTGGGCACTTGGCTAGGTTGGTCAGCGAACCAGCGTGCGAAATGAGACGAGCACCAAC
CGACTCGCCGATGAGCGAGGCAAGGTTGGGGGCCACCGTCGACATCTTGGACACCAGGTACTCGTGCAGCTGGCGACGGTACTCGGCAAGCTTAACGAGA
CGCGTGGTGAAGTTGTCCACGTTGATCATGTCGATCTCCGACATGTCCATACCCATGGAGGAGCGGGCAGCGTGCAGAATCTGCTGggccttgtcctcgt
cgagaacaatcttcgacagctcctcgagcgAGTCTTCGCTCAGCGTGTTGCGGTTCTTAATGAACGACGCGCAGCGCGCGTACACGTAGTTGTCGTTAAC
GATCTTGACGAGCTCGGGGAAGTGCCACGAGTACCACTCACGCACGCGCATGGCGAACGTGTTGATGTCCTTGTCCATCTGGTCGAGCAGGGCAATAGCC
TGGATGATCATGTTGTCGGCACGGTTCACGTTGAATTTGACCTTGGCACGCGAGTACGAGTGGCCAAGACCCAGCTGGGCCTTGGCGAGGTTACCCTGGG
CCAGCTCCTTGACGAACGTGCTGAAGTGCATGCGCACGCCGCGCACGATCTCGAGCGTCGTCTCGCTCGTGTTGCACGGCgcgttgagctcgtccgaGAT
AGCCTGCGCCAGTCCCTTGTCCTGCACGCCGAGGGCGAACTTGCCCTTCTTACCGGCCTTGACCTTGGGCAGGTTCATCTCCAGGAAGTTCTTGAGGTCG
TCGCTCAGTAGACCTTCCGagatgttgttgatgttctCCAGGGCGTTCTCGGCCGACGTGAAGGGCTGGAAagccttgagcttcacgATGCGTCCGAACG
ATGACACGTCCGCCACCGCGGCCTGCACCTCAGCCACGAGGCTGCCGATctcctcgttctccaccacctcaAAGATTGCATAGCCTGAGGCCGACTCGAA
CAGCACGAA