Description :
From Genome Similarity Track
Location :
contig_13:804502- 806564
Transcript NameFunction/comments
g2970.t1hypothetical protein

Sequence
2062 bases(100 bases per row)
AAACCCAAGGAGAAGGCGCCCAAGCCGCGCAAGATCAGCGTCGACATGGTGCCGGAGTGGGCGGGTAACGATACGACCAGCAAGCCCCGCAAGGTCAAAG
GCAGCAAGCCTCGACGCAAGCGCAAGCTGAGCGAAGGCGCACTGGAAGAGCAGCGTCTGGAGGACGAGGCTCGCCTGCAAGCGTCGCAGTTATTGGCTCC
TCTCAAGACCAAGGCTGTCAAGCGCAAGGAAAAGCGTGCCCGTCGTCGCTCCCGTACAGAGTCGATGGGAAGCGAGGCTGTGTCGCAGCCATCGGATGAG
GAAGCCGCGGAGACTAGTGAAAGTGAAGACGATGAGGATGAGGAAGAAGCTGTGAGTCTGTTCAAGTCGAATGATGAGGATGTGGACGCGGAAAAGATGT
TTGGCGATGCTAAGAAGAAGGCGAAGAAAGAAGCGAAGAAGGCCGCCAAGAAGAACACTGTTACTGTTGAGCAGTACGTGGACTGCTGCGTGGCTTAGGA
CCGTCTCGGCATGATTCTCACGTATGATTTCGCATTACTTTTTTGCTACAGGGAAGGGGTGCTGCTGCTTCGACGTCAGCTTGGTATTCGCGTGAGTGGT
GTGAGTGTGCCTGCGCCTATTACTTCGTTTGCGGATATGCGCTTGGACTCGAGTTCGAGTGCGCAGCAGATGAAGCGCGTGCTGCTGCAGAACATTGAAC
GCTCGGAGTACAAGGAGCCTACGTCGGTGCAGATGCAGGCGATCCCGAGTTTGTTGCTTAGGCGTGATGTACTGGCGACTGCACCTACTGGTTCCGGTAA
AACTGCAGCCTTCGCCATCCCAATTCTTGGAAACTTGGCAGCCGGTAGCGGATCTAGCAGTGGTATCCGCTCGATTGTGTTGGCACCTACTCGCGACTTG
GCGGTGCAGATTCGTGCTGAGTTTACGCGCCTTGCGGTGGGCAAGAAGCTACACATCACATTGCTGTCTAAGGCTACTGCTGCTACCATCGCCTCCCAGA
CCAAAAGCAAGCTGGCTGTGAACCATGATGTCTTGATTGCGACACCTCTGCGACTTGTGCATCTGATCCAAGAAGCGAAGGTCGATCTTTCGACCGTGGA
GATTGTGTGCCTAGATGAGGCTGATAGACTGCTGGAGCTGGGCTTCGTAGAGCAGGTTGATGAGATTTTTGCTGCGTGCACTCACGCTAAAGTTCAGCGT
GCCATGTTTAGCGCTACGATGTTGGAGGGAGTCGAGGAGTTAGCTCAAAGTGTGCTGCGTGACCCTGTCAAGGTGGCTGTGGGAACGAAAAATGCAGGCG
CTAGCACGATCGACCAGAAACTCGTGTTTGTGGGCAAGGAGGAAGGAAAGCTTGTTGCCATGAAGCAACTGCTACACGACGGCCTTCAGCTCCCCGCGCT
GCTTTTCGTGCAAAACAAGGAGCGTGCCAACGAATTGTACCACGAGTTGCTGTATGATGGAGTCAACATCGGTGCAGTCCACGCCGATCGAACCAAGGAA
CAGCGCGACGACGTGATTCGCCGTTTCCGCACCGGAGAAGTCTGGGTGCTTATCTGTACAGACTTGATGAGCCGTGGTATGGACTTCAAGGCCGTCAACA
TGGTGATCAATTACGATTTCCCTCAGGTGGGAAGGAGTTATCTGGTACGCGCTTGATTATCCAGACATGGGTCTAATGGTTGTGTGTTTGCTTTTGTTCG
CTTTGACAGAGCGCTGTTAGCTACATTCACCGCATCGGTCGTACGGGCCGAAATGGACGCAAGGGCAAGGCTGTCACATTCTTCACGGAGGATGATATGG
TCTACTTGCGTACAATTGCGAACGTCATGAAAATCTCAGGTTGCGAAGTCCCTGCCTGGATGCTCTCGCTTAAGAAGACTAGTGCATCAAAGAAGAAGGA
GCTTCTAAAGGCACCGCCTATGCGGCACCGCATTAACACGGTCTCCGGATATGACCTGCACAAGGCGAACCGACTGAAGCAGATGAAGCAAGGGAAACAC
AAGAAGGATGATGAATCCACCAATCAGTCCGAATCGCAACCTGCGGGCGATGAGAAGAAGCA