Description :
From Genome Similarity Track
Location :
Scaffold_369:8043- 10049
Sequence
2006 bases(100 bases per row)
GATGTCGAAATGGAGTCAGTCGGCTCATGCGAGTACGACCTAGATGACCTCGACCTTGAATAACAACCGGCGAGGATGGATAATGCCATATTGGGACAGG
CACTCAATGTGGTACGCCGCATCAAGCTCTTGGCGAACACAGATCTCATGAATTTTCATAGGAAATCAAGACGAGGAGCAAGCATGCAGTTGGCTTACCA
CCGTCAAGACCGTATTCACGAGAGATCTAGCGCCCGACGTAAAAAGTGTTTTGTCTCCTAGAGGATTGTTGACTGGACCAGCGCAGAACTAGTAAAGCCA
ACTGGGTCGGTCCGTTCAAGGGAGTTGCAAGGACATAACAAAAGATTTCCACATGCAGTTTAGAGGTTTGCGAGTACCGGTCGCCTGCCAGTACTATCAT
AAGAAGAAGAGGTCGGATGAATCCCTGTTGGACTACCATTTCCGTTTAAATGTGATTAGACCCCGGAAATAGTTAAAAATAAAAGATGAACCGCATAAGA
TTTATAGACTATGTCGAGCACTATATCGAGACTTTGGACGACCCAAATCTAGCGGACCAGTTAGCTATAGTACGTCTGGAGGATGTGGAACAATTGGGGG
ACATGCTGAAGGCGCGTGAACGTATGAAGGCAGAATGAGATATTATTTGAGTCAAGCAAGTTTCGTCAGAAGGTACCGCCTGACCAACCAAGAGATACGA
ACCTCCACTCTGTGCATACAGTTTGAGCGACCCCTGGATAAAATCAAGCTCAGAGGGCTCCAGCAAGGAAAACTTGGATAACGATAACGAAGGAGACTTA
AGGTGGGTTATCAAATGGAAGCGAAAGCGGACAAGGACCTAGGCGCAAGGATGGCGAGGGACCGACCTACCAGGGAGGTCAACCATTATCGACACCAAAC
AGGGGGCCCCGGACCCCGCACTTTGTCGGCCGCTTCTAGCACGAGATTTACCCACTGCTAGACCAGGAAGCATGGAGACTTGGGGTTTTGGAAGCTAATG
ACCTGTGACCGTTGTGGAAAGAAAAGTTACCCATCAGACCGCTGATTATTCATGTTCTAAGGTTGTGGAGATACCCATGATACCGGGCAGTGCCAGATAA
AAGAGCACTACGACTTGATTCCTGATGGTAAAACCCAACCAAGTACGCCGGGATGTTGCCGGAAAAGGCCGAGAAGATGATAATGCTGAAAGCTTGCCAG
GTTTAAATCTAGTACAAGCCGAGTGCTCAAATTCTTGTGTCTTCGCCTATGTGGAAAAGAAGCCCAAGGAAAAGATGGGTGTACCAGCTAAAATCATTAA
AAAACATCGAAGATTAAACTACCCTATGGTACATGTTGCTTCTCTTGATGAGCTTACTGACTTTGCCCGAGCAAACGCAATGATGTAGTTACGCTTATTG
CCGGGAGAGTCCAGGGAGAATGGAAATTCGATACTCCCAAAAGTGGGTCAGTGAAGGTTACATCCTCTCAAAGGGTCAGCAATAATCGCACAAACGTGTT
GTTTGATACTGGCGCCGAGATATCCATTTCGGATACCGCCTTTGCTTGTAAGGTAGGCTGCCAAATCGATTAAAGTGAACGACAAAAATGTATCGGGATT
AAGAAATCCGTATATACTATGAAGGGAGCAATCGCATAAAGATCGCTTAAAATAATTATTTGGTGTATATTTTTAATGTAGGTAGGCCCAATGGGAGGCC
AAAAATGCCATCTTGGGTACGGATGTCATGATCCCAGCTGGTATCCGGTTAGACCTGGCAGAGTGAACAATATGCCTCCCCGACGTAAATGGAGTGCAAT
GTTCCGGACGAAGGGCGATCAATGATAGCCGAGTGTCAGACGTGAAGTTAAGTCAGTGCGCTACTACCTGTTGGGGCTATTTGAATAGTTTTCTAAACAA
TTGGCCACGGAACACCGAAACTGTAGGTCACGAGAGGGGAACGGCGGGTGACTACAATAATCCAAGAGGTAGGACGTCGACGATTCCTGAAGGTGACCAG
CGTCAG