Description :
From Genome Similarity Track
Location :
Scaffold_139:80409- 82480
Transcript NameFunction/comments
Physo_143447hypothetical protein

Sequence
2071 bases(100 bases per row)
GCTATCTTCTACGTGACGAGTACTTGTGGAGCACTGATGAAGTATTCTCGATGTCCACGTATCTCTGCGTTGCATGCTAGTCCTGAAATTCCATGCTTCA
CAGTTTCCGCTCTTCTAGTAGTAGACCTAGAATAAGCGTCCAAGTACAGTATACCATACTGCAGGTTGCCCTTGTTGCCGTGACTAAGCAACGACGACTG
TATGGCCGCAGTGGCATTATGATACCGTTCAAAACATAACAAGGCTAGTAGTAAATACATGCAGTAAAAAAATGTCCTACCTTACATAGTTCGCGTTGGG
ATCATCGATCACCTGCGACGAATGCGGCAAGAAGTTCAAGGTGTTCGGCTCCAAGAAGAAGTGCACGCACTGCATGGACGTGGTGTGCAAGTCCTGCCTT
GCCGCGCTCGAGCTCAAGCACACGCACCTCAACAACCCCGCGAGGCGTGGCTTGCGTCGTCGCAAGTCGCTGGAGCTGTTCGACGCCGCCGGAAGACACC
CGGACGAGCAGGAGGAGCTGCAGTTCCTGTCGCCCATTGGCTCGCCCGACCTGGAGCTCGAGTACGCCGACCCGGGCTCGCCCGACGTGCTGGAGGGTGT
GGACGGCGTGGAGAACGTCAGCGACGAGGAAGATGATCCATTTTGTCGTGGTTGCTTGGCTCACAGTCATTTCGTACGCTAACGTTCACACCACCGACCC
ACCTCTCTACATAGTTTTAAAGGACGGTATAATCTTCAGCCACTTCAAACTTACAGAAAAGCCTTAACGCGATAGTTCTCATACATATTTCTTTTGGTAT
CTCGTGTTATCGTATCTCTGCCCGAATTTTCCGGTGCTTCGTCGTTAGGTGAAGGTAGAGGGATCCAAAACCAGCGATACTTGGCTAATGAACGTCTTTG
CAGTTGCTGTTGCTACTGCTGCTGCTGTAGACGGCGTCGATCCTGATGGAGACCGTGAGTCAGGAGCTGAACGTGCCCAATCGCAGCTTCATCAACATAC
AGCGCTCCAACTGGGTCGAGGTCGTAGTGAGCCACTAACCTCCTTGCCCAGTAGACCTTGCGCACCGCTCAACGCTCGAGTCTCGAGTCCTCTCGCCTCT
GAGCTGACGATGGTGTTAAAATATACAGATTTGTAGGCACAAATATACGTACATGGGGAGTGAATATAAATATGAGTTTGCACCATACAGTTGGAGTGAC
AACAGGGAGAGACTATAATTGTGGGGCACCAATATAACCGCTAACCACTGTGAGGCATATAAATATCAGCTTAATTGTGCTGGCCAAGTTACCATACGGG
CGGCTGCAGACAAAGGTTTTCGTTCAGGAGCGGCCATGGCTGGCTGGCATCAGCTAGCCGTGCACAATTCCACGGGGGAATTCGATGACTACCGTGACGA
GTCGATGTGCTGCTCGGCGATATTTCACAAGGTCGACTTTGACAACTGCCGTGTTTGTGCTGGTGAACATACGATGACAGAAAGACGTCTTCGGTGCTTG
AGCAGCACTTGTCGCGAGTTTGGCAAATGTGGCGTGGTCTGGAAGGTGTTCTACTGCACAGCTCAGGACAAGTGGCAGATAACTGTAAACGAGCAGGCAC
ATGCCCGTGGTGTTCTTCCCTGTACTGCGGAGCATCGGCCAGTCGTGACTCAGCCGATGAAAGCTGTCGTAATGCGGGTTGAAGGATTGTGAGGCGAAGG
ACCCGAAGGTGACCCGAAAGTGAGCCACTTGAATTATGGGACACCCTAGCTCGGCGTCCCGTATAGAAGGCCGGCGACTGATTACGAAACCCGATGGCGT
ATTTACGGAGATCCAGAACGGGGAGGCCCGTAACAAGGACGATGACACCGCACCGAGACAGCAGATGACGTCATGAGGTAAAGGCGTGCAGCATACTGGT
TGGTTGGTTGGCCGGCAGACGAGCCGCCGGTAGATAGGCAGTTCAGTTCAGAATTTCCAACAACGAGACAAGGTACTTCTTCATATTAGTCTTTGTGTTG
TGCGGTTAGCGCCTACGTGTGTACTGTGACTGTTTCCTACCTACTTGTGAAGTGTACTCGGGGTTCTGGAT