Description :
From Genome Similarity Track
Location :
contig_100:80382- 87280
Transcript NameFunction/comments
g12980.t1hypothetical protein

Sequence
6898 bases(100 bases per row)
CTATGTGTTTGTTGATTAATCGTCGTTGCTTCTGCATCTGTTGGGAGCGTTGGCTCAGTGTCTTCTGGATAACCTCAGCTGGGGTTTTCATGATCGGGTG
TGGGTGTTCCTGCTCAGTGTGTTTCCAGTCTCCTTCTGAGGGAGTGGTCTGCTATCTAGTGGTCTCGCTGTGTTGGTTGATGCTGGTGTTGAGCATTCTA
CAATTCTTTCCCCCTGTTGATCAGAACGACGATTGTTGTTAGATCCAACCGTGTGCCACTCATACTTACCTTTGTTGTGTGTTTGGTGAGTTGCCGTTGT
ACTGGGTTTTTGCTGGTTCTGGTTGGTTGTTGGTTGATTCATGGGCGTTGTTGATTGCTGAAGATCCGTCGTTGTTGATACCGGTTCCTTGCTCTCTGGT
TCGTTTTCTTCGTCAACCCAGTACCGTCATCTCCTCAAAACTGGTAATTGTTCGTGGTTGTTTGGCAGTTCTGCAATGTTTTCGGCTGTGACTTGTAAGC
AGTGTTCTGGTACCAGTAGTCATCTTGAGCGTTGCATCTGTTGCGTGTGTGTCCGATTGCCCGCATTGGAAGCATGGTGGTGCTGGTTTGACATTCACAT
GGTGGATCAAAATCTTGGTCCCGTTCCAGTTAAGGAATCTCTGGCTTACTAGGAATGGCGGGCATAGCGGGCTTCTGAAGTAGACGTCCCAAGTGTCCGT
TTGTCTCTCATAAGATCCTGCTGATGGTTTTGCCAAGTCGTGTACTTGCCCTTGAAGTTCTGCTGTAGATATGCGTCAAGGGCTGCTTCGTCCATGAACC
TTGACACGTTAAGTAGTCGAACATGGTACCTGTCTCGGGATTTCTCGTCCCGTACTCCATCTGCTCCCATTTGTCTGGCCCATAGACTGGTGGAGCTATG
ACCTATAGTGGTAGTTGGTTCCCCGGTTCTCATTTTCATTTCGCAGGGCGAAGTTCTTGTGGCGGAATGGTAGAGACTTGAATTCTTTCCCCCACACGCT
GCTTGCTCTCGTGTCCAGAAAATCAAATGGATCGCATGCTGGTTACGGTCGTAACAGACTTGTTTTGCGCTTTTCAGGAATGCTACGAGTCGCTCCTCTG
GGTGTTCACTTCTGCGTTTCCCTAGTAGGATCATACCTACTAGTCTTTCTCTCGTTTGGAAGTCAGGGTACACTGGGAAATCTACCGGTAGATGAATGGC
TAGTCTCCTTCCACTTGGGCTTGGATTGTTCTGGATCATCCGAAGAGCATACGCGCTTGAGGAATGATGGCAAGTGGGCACAGAGAATGGTCCCCTCCAG
CAGTCCTCTGATGATGGTTTCTTCTTTTTCTGTTGGCTTGCGGATTTTGCTAGGGAATCCGTAAGGAGTTTCACAAATTTGGCGATATACAGGAATTTCA
GATGCTGGAAATGCAGTGGTCATGAATCGGTACGACGAGCTTTCATCGCCCGTCATGTCGACGTCTGTGTCCGGTTCCTTCTGGGGAGCTAGTTGGTCAT
GTTGCTGGGCCCAGGCGTTGACTACTGGGGCTGTGGATGCCTTGGAGGTTGCGACTCTGTGGTCAACTATTTCAGTCAGCATGCGACGTGTTTTACAGTG
ATCGCGTGATATCATGCAGGCTCGCCCTCCATTTTCTCGCGTCTGGTCGACCAATGGTCGCGTCCACCAATAACAAGTTCAGTAGTTGTTCTTTTTCATC
GTCAGTCAGAGTCGGGTATCTGCGTTGTTGTTCGTTAACGTCAGGTCTGGGTGCGTTTGAAGACTGTAGTGAACATGTTCTCCATATATTCCAGCGCACT
GACGGTGTCTTTTGTTTCTTCACCCCTTGCCTGCTAGTTCTCCGTGCAGGTAGAGATACATCTCCGCGAACGTTAAGGCTCCTCTTCAATCTCTTCGTAC
GTTGGCTGATCATGGTGCTTCATGTCCTCGTCCTCTTGGTTGTCTTGCATAGTTTCTTCTTCTTCCAGCACTTCAGGCATTTCCTTGTCTTCCGTTGTTT
CTCCACTCTCCTACCAGCGGCGTTTCGGCGTGCTTTCCGTAACCGGTTCTTCTTCTGTTTCGGTCGGATTTTGGTGACGTTTGACGCCTGCTGTCTGCTC
TCCCTTGGCTTCCTCTGGCGGAGGTGATGGCGTGCAGACGTCGATCACCTCTCGTGGGTTGTCTGGAGGTTGGTCCGTGTCCTGCATCCTGCTTGACGGT
GATGTATGTGCGATCTTACCGTCCAGCTTGAGCAGAGCCCCTATACTTTAATCAAGTGACTCCCCCCTGCGATCTTTGACCCTTGGCTTTTCGTGCGGTT
AACTTCCAGTTACCGCTGCTGTTTCTTTTGCGACCTTTCCCCTTCGACGCAAATATGGAAGTGTTCATGGGCTTTTAGAGAAAATGTCTTCGTGTGATGG
CGTGATCCCTAGGAAAGTGTATCCGTGGGATTGCGTGAGCCAAGGAGTTTTATTTTAAATGAACTGGTTACGGGTATCCAAAGCATTCCCTGACTCACCA
CTTTGAAACTAGACGAGAAAGTTCGCCTCCAACAATAACAATGGGAAGCAGCGCCCCACCCCCACCCGCCGAACGTTCACACGCTAAGCGACGATGTGAT
CAGAAACGTGATGTCATCGCACCTCTGGCCCAAACCTGGAGTCGGGCGTGACGGAGACGACGAAGCCTGGAGCTCAAGGACGACAAACTACGCGAGTTCG
AGACCACAGTATTTCCAACAGCTACTTAACAGCGTCACCCTCCAGGCACCTGCTGCAGCTCCTATCAAGCACAAAGGCACGCTGGACCCCTCACAGCCTG
TCGGCATAGAGAACCAATCCGCTGATAAAGTACGGGTCACAGAGGAAAATGCTGATGCGGAGCTCCGCCGGCAGCGCCGTCGGACGAGCATGCAGAGGTA
CCGGAAAAAGCTCCAGGACCATGCAATCGCTCTAGAGCGTGACGTCGGAGAGCTACGAGAAGAAATCCAAAAGCTCCAGCTCCAGTGCCAGGCTCTCTCT
TCTGGTGTCCCCACCGGAACGACTGCCTTGGCGGTGGTGGCAGAATACTTTCGCCTGTTCCGATACGGCTTGAAAGGGTCCGCCCCAACGAACGACCCTG
GCAGCAGCACACACGTGGCCCCGGACACGTTTGTTTCTAGCGTGCAACGCGATTTCCTCCATGCAGCGGTATCACCGGATGTGGTGGGCGAGACGGGATT
CGGCGTCGAGAGGCTCATTGAGGACTACCGGCGTCTCGCTCTCTACCTGCCAGACTCGGACACCCAACTCGTGCGCCTCGATACCGGTCCTGGAGACTCG
TTAACCGCCATCGCAGCAGTCGCAATCGTCGTCACGGCGAAGATGCTGCATTTTGCATTTCCTTACCTCGTCCGCGATGGAAATCGAGGTCAGTGGTCAA
AGCTTGCTGCCACGTTGCTCGGCCAGCGGTTCATGCTGCGTGGCTCGATCCAGTTCAAGTGGGACAGTGTGACAAGCCGCGTGAAGCTCGTGCAGACCAG
AGCAGGCATTTTGACTCCGATTCTGCGATTACTGGGCGACTTGGAGACCATCTCCCGCGTGTTCGACAACGCGCTCATTACTCCATAGTGTAAGCTAACA
CACTATGCCAGTCCCAAATGCTTCATAGGTCGCATAGCGTTCTTTTTATCCTTAACGTGTATACACCCGGCCTACAGATTCATGAACTGCGAGCGGAATC
TCATGAGAAATCGTTGATGACGATCCAAAATATTTGAGCGGGGCATCAAGGTTCGCCGTTACCTTTTGGCCATATAGCCCCCCTTGGTTTACCTCGCTCA
AAGTTATATTTTCATTAGCCTACTACAATTGTGCCCTTATTTATACGTTCATTAGCCGACTACAGTTGTGCCCTCCGGTAGTATCAATTTGATTGCCTGG
GCCACGAGCGCGCTCTTGCTACAGTACATGCATTAGCTCGTGGCGATTCAGTGGACTGCATCATGTGCTAACCTCGTAAACATCGCGTTTTTGGATACAC
GGGCATTGCAACGCACCACATTTGTTCGTAAACACGTTGCTGCCCCCGCCGATAGAGTTTTCAACCTGTACATGCACTTCGTTTTTGCTCCACAGAGCCG
CCGATATTATCATACATGTACTTGAGTCCAACAGCTCACAATTTGAACTTCGCTATACAAATTAAACTTAATTAAATCAAGTGGTGTATTCGCTAGTTGA
CGAATAGAGAGTTGGGTTTGACATGCAAGCCCAACAACCTAAAGACGGTCGGGCCACCTCAACTTGAACTTCTCAAGGTATGTACGATGCAACATCTTGC
CTGCTAAGGAGCTACCCACAATCTTGGAGACAGCTTCAGGGTCCTTCCTGGCAAGCACCCACTTGCTCAACAGCGAAGCCTGCATGTCTGTGGCAATCTT
CTCCGTCACTGGGTCTTTCTTCGCCGCAACGAGCATTTTGGACAGCGCGTCGTCACCGAAGTTCCTTCTGAACGTGTCGATCATCGATACCTGGTTCTTT
CGGGGCAATCCCGAGTTCAGATCGTCCATGTACTTGACCCACGCGTTCAAGTTCGGGTTCTTAAAAACCTTCTCTGCTCCAACGTTCAGGTTCAGTGTCT
TGAAGGCGTCGTCTGCAGAAAGCCCCATATTCTTCCAGCCCTCCAACTGCTTAGTTTGCAATGCCGTCGCGGCTTCCTTCGTTTTAGGCATCTTCAGTCC
AGCCTCGAGCATCTTCGACAGAACGTCGTCGCCGTATCGACTCGTCAACGAAGTAACCATAGCTGCTTCTGGGTGTCTCGGATTGATGAGACGGACGTAC
GCGACCAAACATTGACGTCTGAGTTGTCGAACAGCTTCGTACCAGCCTTGTCCAATTTCAACTTGGAGAACATGTACTCCGACGACTTCTTTCTGTCGGC
ATATTTCAGGAGATCCTTAAGCGTGACCTTCTTGGAGAATACATTCTTGATCGCCTCGATCCCTGGGATGGATTTAAAGCTAATCGCTCTCTCTTCGTCG
TCCTCGCCCGTGACGCTGTCAGCTCTCAAAAACCGCTTGGAAGTCAAGGTGTTTTGGGCCGCATTGATCCGCGACGTGACCAGCTTCGAGTCTGCCACTT
CGTGGGAGGCAGTGACACCTGTAGCGACGAAAGCAGCAGTAGCTAGCAGTACAATGTACTGGAGTCTCATGACTGACCCTGACAGACGTTCTTTGAATCT
CAGCAGTGGCGAGCAAGTTGGGAAGTGGGAAAAATTGATGGGCTACGATTTCTGCGGACATGGAGACGTCGGGAGGTACGGATACATACGTGTAACGCAC
TCTCTACAGTGAATCGTCACGACAAATTGTCGGACAACCGTGGCGGTGTAGCTTGCGGTAACCAGTGGCCACCATCAACATGTACCGTTTTCTGGCCAAC
CGATCGTACTCTTAATCACCATCCCCGTGTTTGGCAAATAATAGAGAAGCGTTGCGAGTGCTGCATTTATCCGGGTGCTGCATGCATATGACTTTTGCGG
TATTGGTGCTCGATACGATTACGATGTCTGCAAGTTTATGCGGCATGTAGATATTGTGCGTTGCTGGGTCGTCTGCGGCTTACTGGGAATGCATTTTTTG
TTTGCTGGTGGTGGTGCAATGAAGGCCGAGTCTTTGTCGAGAATAGGTGATTCTTTTGTTTTGATACCAGTTTGGTAGATCAGTTGTCGCTGTCGCAAAT
ACGAGGTTACCGTCTCCGATAAGCCGATAGTTTCACAAGAAGAATTGCGCTTAGGTATCGCCACTCAACACAGAAATGATGGATGCTACAGTCTGCTGGA
TCCTGAAGTCCCGCGGTACCTCGACATTGACAGCGCTTTTGAAGCACTGTCGATTCTCATTCACCAGACTCATGACAGCATACTTGCAAGCCAGTGTCTG
CGTGGCTAGATCGCACAGTGTATCGTAAATTCCACTTGCTCCTCTGTGGTACCACCAGCGTTCTTCTCGCGACTGTTTAGACGTAGCCGTTCCTCCTATC
CTTGCTCTCTTGATCGCAGGGTGCAAGCTGCAGTAGCCAAGTAATGCCCACAATGTTCGGCATCGCAGACACTAAACCCCTGGGAGCACCAGCAAGTACT
CTTCCACCGCGTCGCACATTATTGTGTATTTCTTCAGGCAACACGGCGCCATCGGCTGTCGCTCTATTCACCGCGGCCACAGCCGCCGTCATGTCGGCCT
CCTCCTTCTCGAGACCCGCAGAATTTGGGCACCAAAGCAATTCGATCACAATACACTTTACCATTGCCAAAACCACGCCGCCCATATATCCAGCTTCATT
CTATTCATATCAGGTGTTCCTTATTGATGCACATTACTGTACTTTGACTAATACAGATGTCCCCAACAATTTACCTCGCACAGGTAGCATGGAATTTGAA
ACTGGCCGGGATGGGATGTACTAAGATAGATGCAACTTGGACAGGAAATGCTGTGCTGCGGGAAGCTTTCTGCACATGCAAGCAACACATTCAGAGTAAC
TTAGTACTTTTGCATCTACCGGTATAGTACACCTGTGCAAAGTTGCCGGGGACATCTGTACGTGTAGTAAAGGAGCATCCTTCAGGCGAATCGCCTAGGT
TGATAGGGGGGGGGGGGGTAAATAGAAAGCAATGTACAGTAGTATTTTTATACTATTAACACTAAATGACTGAGAACCACATACCGGAAATGTCCCTTAT
TCGGAATGCGGTCAAAAGTTGACTGCGAATAATCGCTCGATGCTTCTGCAATTTGGTCATCGTATCGACACTCACTAAACATTTAAAATGGTGGAGCCCC
TGTCCTCAGAATCGCTCTGACGTGCAAGTTATTGGAGCACAAATGTCGGTGCCGGCGCGTCCAGGAGGCATTTTGGCCGCAGCTTCTAGTGTGAGCCC