Description :
From Genome Similarity Track
Location :
Scaffold_95:8038- 10258
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_95-fgenesh-gene-0.7Guanylate-binding protein, N-terminal domain containing protein

Sequence
2220 bases(100 bases per row)
ACTCTCTAGAACTTGAAGTTTTGCCTCAAACTCTTGGATTTCCTGGTTCACGCGGTCGATGTCGCTTTGAACTGCGCTCTTCTTCTTTTGGTACGCGAGT
TTGAGTACTCCCGTGTCAGTCTTAGCCTGCGACTTGAGCTGGCGCGAGAATTCGGCTTGCTCTGCCTTGAGCTCGTCAACCCGCTTGGCCTGCTCGCTCT
CGATCACGAACACATGCTGAACATGCTTGGTTTtCTTTTGCACGAGCTCCCGCTCAAGCTCAaCGACTCGGTCCAAGAGCTCTTTGTGTTGTGTCATTAA
CGAGCGCTCTTCTTGATGGAATGATCGTTCCTTCTCGATCATTTCTTGTGTTGCGCCAGTCAAcGCCTGATCCAGGCGATCTCTCTCCGCTTGCGCCGCT
TTCTCGAGCTCTGCAGTTCGACTTCGCACCCATTCAAGGTCGCTCTCCAtATTTTTGACACGGGAGTTGTGCTTCGCATCCATCGTCGACATGTCCCCCA
AGAGACGATCGAGTTCCGCCTTTTtCGCATTCAACTCACCATGCAGCACACGACGCAGCTCGGATAGCTGTtGGgTGGACTGcTCCAaCTGTTCCTCATA
CAAACGCTTCTGATCTtCAGCGGAGAATGATGCACTTTTATCTTGGGTATTGGCAGCTTCCATCTCACCATCCAATTGAGACTTTTCCTCCTGCAAATTG
CGCATGTGCTGTTGGTACTGACGGAGAACATtGGCTCCGTAGGACTTGATCGAGTCCATCACACCAGCCTGAAGAGCTTGAGATAGAGACTCATACACGG
CTGGTCCGGCACTCTCTGTCTCGTAGGCATCtACGGCGTCGCGAAGGTCTGACTTGTACTGAATCAGCAAGGCGAGAATGCCGTCACTGAACGATTCTCG
GGCACGTCCATCCAAGTCAGCGGCGATCTGTGCAAGGGTTGCAGGCAACTTCTGTTGCAACAGCTGATCGCATAGCTCTTTGGAGATGGACGCGTTCCTC
TCTTGGAGCTTTTGAACTTGTTGAGTGCAATGCTGTCGAAGCGCAGTGACACCGTCGCGATAAGCAGTTTCTCGGACCTTCTCTGGGAGcGTCGCAGCCA
CGGCCTCGAGAGACGTCATGACGCGTTGGATACCGCGTAAATGCGCTAGTCGGACACGTCGGGCATCTATTGGagCTATCTCTTCGTGATCGATGGCTTC
TATTCCCAGGTTTTCCTGCATCACCTCTTTATgCTCTAGTCGAGCGcGACCcAACGCTTCTTCTAGCGTGTGTTCTGTGAGTGCGTTGAGAGCCGAGACG
ATGGCAGGAGGCACGTTGTTGTTGATGGCTCGCACGTACGCGtCcACGACATGTGGAAACTCGCGAGCCTGGACTTCTCTTCCCAAAAGaGACTTGGCAG
GCgTCGACATGGCTGTTGGCGACAAGAACGTCGTGTAGATCTTGTCGACAGCCTCGACGAACTGTGTTCGCAGCACATCGCGACTCGgTAGCTCTGTAGA
TGGATCGCTGGCTTCCACAGCGCGACTCAAATGGATACATTCGCGGGTCGTGAAGTACTGGTGCACATACATCCGCTGGGCGTTGCGTTGCATGACGGCC
TCGCTAAaGCCACCTTCgTctGCAaGACATCGCTCCATGTACTGCGTTGGTGTGAGCTTATCGCCTGTCTCGACGTCGTTGAGCCATTTCACTTTCGCGt
tctGCTGCACCCAGACCAACTTGGGCGCGTGCAAGTGGAAGTCCTTGGTCACCGCCTCGTCGTCCTGGTTGGGCTTGATACGCACCATGGACGCAATGTC
GCGCAGCCACGACAACcGCTCCAATGCGGCTGCATCAATCTCTCCGTCGTCGTTGTACAGCAGCACaGAACTGAtCAGCAGTAGCAGTGCCATCGCATGG
CGCCTGTCGCGATGCTCGTCGTCGACGTCCATGTGGCCAACTGATACCACGACGCGTGCATTGTCAGGACGAGTACCCTCTGACGGTGGTGTCCACATCC
ACAGCAGCACTTTGtCCTGTTCCTTGGTGGCATCCTCGTTGAAGGCGACCGAGTCGGCGTGAAGCAGAGTGCGGAGCAGCAGCTTCTTCCCCGAATCTGG
ATGCCCCGTGACGCCCAGCACGTGGATGGAGGGCGACgaCAATGCCTTCAGGTACGCGCGCGCCTGCTCTGGTACATGCAGTGATGCGTCTCCGCCTGGT
GCACGCACCACAAGCGGCAG