Description :
From Genome Similarity Track
Location :
Scaffold_33:80368- 82588
Transcript NameFunction/comments
Phyci_6349Hypothetical protein

Sequence
2220 bases(100 bases per row)
CCACGAGTACGTCGCGTTTACCAGAGTCCTCACGACTGTCATAAAACAGTCGCGGATACCATCCTCCGAACGACCTCGGTATCCCACATGGGTACTGCAG
ATCCATCACCTTTTTCAAGAACTTTACCTTGGTTTCACTCAGCTGCTTGTGCTTGAGCTGGTCATTTGCAATTGACTCCAGTGACTGCATTATCGCACTG
AAGCGGTGAAAGAAACCCCGAGCTCCATTCAGAAACCAATTTGTGTCATGAGAAAAGCTCCTGCGAGCCCCACAGAATTGGACCAGTGGACAGATATCAT
GGTCAATAATGCCCTCCATCTGTTTCGCAAGTTGCACCATTCGCTGCCAGAAAAGTGGATATGGGTCCACCATTCCATCCGCGTATTCACAGGCACACAT
CGGAATGTAGCACTGTTTCGCGTAGAGCAAGCTATCGTGTCGTAGTTGAGTGAACGATGCAAGCTGCGTGTTCATTTGGCGGAGCTGCCAGACAGCTGTG
TGAAAGGTACGAGCGGTATTTGGGGACGGCCTTGACAATGCGCGCAATGCTCGCTGCCATAGCATACTCATACTCGCACATTCCTCGCCTCCGTCATCGA
TCTCTTTTTCGACCACGTGCCGGGCAGCGACAAGGTTTGACGTGAACGGAATGCCATCTCGGAATGGTACGAATTGTGAATTACTCAAAGGTTTTGATGG
AGTTGCGTTCATCCGGTCGGTCAGCACTTGGGCAGCAATGTCGTTCCCGAAAAGCGCGAAAGCGACGTCGACGGCGCTGGGAATACGACGCACTTGTTTC
TCGTCATTGTTAAGCACTTGGTCGTAGACTAGTCGCGAAAAAATGAACGAACTCCAAACAAAGCGTTGCCCAAGTAGTGCGAACGAAGTCACCGCTGTCA
TCGGAGTTGTTGATTCGCATGGTTCATCAACAGCACGCGGATGACCATTAATCAGTTGGGCTCCTCGCCTCTTTTGAAGAATTTGTTTCTGAAGTTCCAA
AAAACCGCTGCAACTTGATGGTTTTGCTTTGAGTACGTTGGCCCCGTAGAGCTCTTCCTTATTCACATGGCGTCCGAGCTTTAAACCCAACCCAAAAGAA
AACCGCATTCGTTTTTTGCGGTTGTATTCATCATCACGACGAAACAGAAACTTTGCGAGGTGGCTTGGTGAAAGCGAGTCAGCACCAGCACCATCATCGG
ACATCAACTTTGAAATCAGTCGATCGAAATTCTTCGCTATCTCCAGGCTTCCCGACTCCTGCATAAACTGCACCAGCAACGCAGCGCAATGCAATTGATG
AAGATTCTCGTCCTGATTCCTTCCGCCAGCAACGCGTAAATCCATCGTGCCCAGCCATATCGTCGCCCGAAAATATCTGGTTAGCTCTTCAGACTTCGTG
TAGTGTCCGCGAGGCTTGAACTGCGAGAAATCAATCTCCCTCTTGGCCGAAAAGATCTCCGCCTCCATGGTTCTTTCGGCGTCGATTAACGTTAGCAAGA
ATTCCAGCTTGGCTGAGTTCTCAGGCATACTGCCTAGCTGTTCTCCTCGGAGAAGACTGAGCCCCACACAAAGGAACAGTTCTACATCGAGCATCGGATT
CACTTCGCTGACGTCTCTTCCGGCGACAGCCATGATGGCATCTCGACACTTCGAAAGCGTGGATTCAAGGACTTTATCCAGTGTAGGACAAAGAATTTCA
ACCTCCAATTCGACCAGGAACGCGTCGAAGCTGCGGTGCCACGCGTGCAACACGGAGTCGGAGGTCACGAAAACTGGCATATCATCGCGGTACAACTGGT
CGTACGCATCCGCAAAGCTCTTGGCCGGCATGCGTTCCACCGCGAGAACCCCGCTGGCAGCTAATTTGGCTTTCTCACGAGAGGTGAGACGATAGTCGAA
CCTTGGCAGCTTCAGCGGGTGATGCCCAGTCGAGATCACTCTTCCTTCTTCTTCCTGAAGTACCGAATCAATATAACCAGGATCCCCATCAAATAGATCG
AAGTACTTGCATTTTTCCAGCACAATCGGCGTGGCGTCTTTCTTGTCGCTCTCACTCGCCATGGGGTACAGCATGAGAAGGTCTTCTGGCGTCAAGTTGG
TGCCGATTTGCTTCAAAGTCGCCGCAAAGGCAGCCGTCACGTCGCCCCCGCCCATGTTCCTCAGTTTCGGCTTGACTTGTTCGTCCTTCGACTCAAATTC
GTAAGTGCGGACTCGAGCGG