Description :
From Genome Similarity Track
Location :
contig_100:80363- 87261
Transcript NameFunction/comments
g13498.t1hypothetical protein
g13499.t1hypothetical protein
g13500.t1hypothetical protein

Sequence
6898 bases(100 bases per row)
TTGATTAGTCCTCGTTGTTTCTGCATCTGTTGGAGCGTTGGCTCAGTGTCTTCTGGATAACTCAGCTGGGGTTTTCATGATCGGGTGTGGGTGTTCCTGC
TCAGTGTGTTTCCAGTCTCCTTCTGAGGGAGTGGTCTGATATCTAGTGGTCTCGCTGTATTGGTTGATGCTGGTGTTGAGCATTCTACAATTCTCCCCTG
TTGATCAGAACGACGATTGTTGTTAGATCCAACCGTGTGCCACTCATACTTACCTTTGTTGTGTGTTTGGTGAGTTGTCGTTGTACTGGTTTTTTTCTGG
TTCTGGTTGGTTGTTGGTTGATTCATGGGCGTTGTGATTGCTGAAGATCCGTCGTTGTTGATACCGTTCCTTGCTCTCTGGTTCGTTTTCTTCGTCAACC
CAGTACCGTCATCTCCTCAAAACTGGTAATTGTTCGTGGTTGTTTGGCAGTTCTGCAATGTTTTCGGCTGTGACTTGTAAGCAGTGTTCTGGTACCAGTA
GTCATCTTGAGCGTTGCATCTGTTGCGTGTGTGTCCGATTGCCCGCATTGGAAGCATGGTGGTGCTGGTTTGACATTCACATGGTGGATCAAAATCTTGG
TCCTGTTCCAGTTAAGGAATCTCTGGCTTACTAGGAATGGCGGGCATAGCGGGCTTCTGAAGTAGACGTCCCAAGTGTCCGTTTGTCTCTCATAAGATCC
TGCTGATGGTTTTGCCAAGTCGTGTACTTGCCCTTGAAGTTCTGCTGTAGATATGCGTCAAGGGCTGCTTCGTCCATGAACCTTGACACGTTAAGTAGTC
GAACATGGTACCTGTCTCGGGATTTCTCGTCCCGTACTCCATCTGCTCCCATTTGTCTGGCCCATAGACTGGTGGAGCTATGACCTATAGTGGTAGTTGG
TTCCCCGGTTCTCATTTTCATTTCGCAGGGCGAAGTTCTTGTGGCGGAATGGTAGAGACTTGAATTCTTTCCCCCACACGCTGCTTGCTCTCGTGTCCAG
AAAATCAAATGGATCGCATGCTGGTTACGGTCGTAACAGACTTGTTTTGCGCTTTTCAGGAATGCTACGAGTCGCTCCTCTGGGTGTTCACTTCTGCGTT
TCCCTAGTAGGATCATACCTACTAGTCTTTCTCTCGTTTGGAAGTCAGGGTACACTGGGAAATCTACCGGTAGATGAATGGCTAGGTCTCCTTCCACTTG
GGCTTGGATTGTTCTGGATCATCCGAAGAGCATACGCGCTTGAGGAATGATGGCAAGTGGGCACAGAGAATGGTCCCCTCCAGCAGTCCTCTGATGATGG
TTTCTTCTTTTTCTGTTGGCTTGCGGATTTTGCTAGGGAATCCGTAAGGAGTTTCACAAATTTGGCGATATACAGGAATTTCAGATGCTGGAAATGCAGT
GGTCATGAATCGGTACGACGAGCTTTCATCGCCCGTCATGTCGACGTCTGTGTCCGGTTCCTTCTGGGGAGCTAGTTGGTCATGTTGCTGGGCCCAGGCG
TTGACTACTGGGGCTGTGGATGCCTTGGAGGTTGCGACTCTGTGGTCAACTATTTCAGTCAGCATGCGACGTGTTTTATACAGTGATCGCGTGATATCAT
ACAGGCGCGCCCTCCATTTTCTCGCGTCTGGTCGACCAATGGCCGCGTCCACCAAGAACAAGTTCAGTAGTTGTTCTTTTTCATCGTCAGTCAGAGTCGG
GTATCTGCGTTGTTGTTCGTTAACGTCAGGTCTGGGTGCGTTTGAAGACTGTAGTGAACATGTTCTCCATATATTCCAGCGCACTGACGGTGTCTTTTGT
TTCTTCAATCCCCTTGCCTGCTAGTTCTCCGTGCAGGTAGAGATACATCTCCGCGAACGTTAAAGGCTCCTCTTCAATCTCTTCGTACGTTGGCTGATCA
TGGTGCTTCATGTCCTCATCCTCTTGGTTGTCTTGCTTAGTTTCTTCTTCTTCCAGCACCTCAGGCATTTCCTTGTCTTCCGTTGTTTCTCCACTCTCCT
TCCAGCGGCGTTTCGGCGTGCTTTCCATAACCAGTTCTTCTTCTCTTTCGGTCGGATCTTGGTGACGTTTGACGCCTGCTGTCTGCTCTCCCTTGCCTTC
CTCTGGCGGAGGTGATGGCGTGCAGACGTCGATCACCTCCCCTGGATTGTCTGGAGGTTGGTCCGTGGCCTGCATCCTGCTTGACGGTGATGCATGTGCG
ATCTTACCGTCCAGCTTGAGCAGAGCCCCTATACTTTAATCAAGTGACTCCCCCCTGCGATCTTTGACCCTTGGCTTTTCGTGCGGTTAACTCCCAGTTA
CCGCTGCTGTTTCTTTTGCGACCTTTCCCCTTCGACGCAAATATGGAAGTGTTCATGGGCTTTTAGGGAAAATGTCTTCGTGTGATGGCGTGATCCGTAG
GAAAGTGTATCCGTGGGAATGCGTGAGCCAAGGAGTTTTATTTTAAATGAACTGGTTACGGGTATCCAAAGCATTCCCTGACTCACCACTTTGAAACTAG
ACGAGAAAGTTCGCCTCCAACAATAACAATGGGAAGCAGCGCCCCACCCCCACCCGCCGAACGTTCACACGCTAAGCGACGATGTGATCAGAAACGTGAT
GTCATCGCACCTCTGGCCCAAACCTGGAGTCGGGCGTGACGGAGACGACGAAGCCTGGAGCTCAAGGACGACAAACTACGCGAGTTCGAGACCACAGTAT
TTCCAACAGCTACTTAACAGCGTCACCCTCCAGGCACCTGCTGCAGCTCCTATCAAGCACAAAGGCACGCTGGACCCCTCACAGCCTGTCGGCATAGAGA
ACCAATCCGCTGATAAAGTACGGGTCACAGAGGAAAATGCTGATGCGGAGCTCCGCCGGCAGCGCCGTCGGACGAGCATGCAGAGGTACCGGAAAAAGCT
CCAGGACCATGCAATCGCTCTAGAGCGTGACGTCGGAGAGCTACGAGAAGAAATCCAAAAGCTCCAGCTCCAGTGCCAGGCTCTCTCTTCTGGTGTCCCC
ACCGGAACGACTGCCTTGGCGGTGGTGGCAGAATACTTTCGCCTGTTCCGATACGGCTTGAAAGGGTCCGCCCCAACGAACGACCCTGGCAGCAGCACAC
ACGTGGCCCCGGACACGTTTGTTTCTAGCGTGCAACGCGATTTCCTCCATGCAGCGGTATCACCGGATGTGGTGGGCGAGACGGGATTCGGCGTCGAGAG
GCTCATTGAGGACTACCGGCGTCTCGCTCTCTACCTGCCAGACTCGGACACCCAACTCGTGCGCCTCGATACCGGTCCTGGAGACTCGTTAACCGCCATC
GCAGCAGTCGCAATCGTCGTCACGGCGAAGATGCTGCATTTTGCATTTCCTTACCTCGTCCGCGATGGAAATCGAGGTCAGTGGTCACAGCTTGTTGCCA
AGTTGCTCGGCCAGCGGTTCATGCTGCGTGGCTCGATCCAGTTCAAGTGGGACAGTGTGACAAGCCGCGTGAAGCTCGTGCAGACCAGAGCAGGCATTTT
GACTCCGATTCTGCGATTACTGGGCGACTTGGAGACCATCTCCCGCGTGTTCGACTACGCGCTCATTACTCCATAGTGTAAGCTAGCACACTATGCCAGT
CCCAAATGCTTCATAGGTCGCATAGCGTTCTTTTTATCCTTAACGTGTATACACCCGGCCTACAGATTCATGAACTGCGAGCGGAATCTCATGAGAAATC
GTTGATGACGATCCAAAATATTTGAGCGGGGCATCAAGGTTCGCCGTTACCTTTTGGCCATATAGTCCCCCTTGGTTTACCTCGCTCAAAGTTATATTTT
CATTAGCCTACTACAATTGTGCCCTTATTTATACGTTCATTAGCCGACTACAGTTGTGCCCTCCGGTAGTATCAATTTGATAGCCTGGGCCACGAGCGCG
CTCTTGCTACAGTACATGCATTAGCTCGTGGCGATTCAGTGGACTGCATCATGTGCTAACCTCGTAAACATCGCGTTTTTGGATACACGGGCATTGCAAC
GCACCACATTTGTTCGTAAACACGTTGCTGCCCCCGCCGATAGAGTTTTCAACCTGTACATGCACTTCGGTTTTGCTCCACAGAGCCGCCGATATTATCA
TACATGTACGTGAGTCCAACAGCTCACAATTTGAATTTCGCTATACAAATTAAACTTAATTAAATCAAGTGGTGTATTCGCTAGTTGACGAATAGAGAGT
TGGGTTTGACATGCAAGCCCAACAACCTAAAGACGGTCGGGCCACCTCAACTTGAACTTCTCAAGGTATGTACGATGCAACATCTTGCCTGCTAAGGAGC
TACCCACAATCTTGGAGACAGCTTCAGGGTCCTTCCTGGCAAGCACCCACTTGCTCAACAGCGAAGCCTGCATGTCTGTGGCAATCTTCTCCGTCACTGG
GTCTTTCTTCGCCGCAACGAGCATTTTGGACAGCGCGTCGTCACCGAAGTTCCTTCTGAACGTGTCGATCATCGATACCTGGTTCTTTCGGGGCAATCCC
GAGTTCAGATCGTCCATGTACTTGACCCACGCGTTCAAGTTCGGGTTCTTAAAAACCTTCTCTGCTCCAACGTTCAGGTTCAGTGTCTTGAAGGCGTCGT
CTGCAGAAAGCCCCATATTCTTCCAGCCCTCCAACTGCTTAGTTTGCAATGCCGTCGCGGCTTCCTTCGTTTTAGGCATCTTCAGTCCAGCCTCGAGCAT
CTTCGACAGAACGTCGTCGCCGTATCGACTCGTCAACGAAGTAACCATAGCTGCTTCTGGGTGTCTCGGATTGATGAGACGGACGTACGCGACCCAAACA
TTGACGTCTGAGTTGTCGAACAGCTTCGTACCAGCCTTGTCCAATTTCAACTTGGAGAACATGTACTCCGACGACTTCTTTCTGTCGGCATATTTCAGGA
GATCCTTAAGCGTGACCTTCTTGGAGAATACATTCTTGATCGCCTCGATCCCTGGGATGGATTTAAAGCTAATCGCTCTCTCTTCGTCGTCCTCGCCCGT
GACGCTGTCAGCTCTCAAAAACCGCTTGGAAGTCAAGGTGTTTTGGGCCGCATTGATCCGCGACGTGACCAGCTTCGAGTCTGCCACTTCGTGGGAGGCA
GTGACACCTGTAGCGACGAAAGCAGCAGTAGCTAGCAGTACAATGTACTGGAGTCTCATGACTGACCCTGACAGACGTTCTTTGAATCTCAGCAGTGGCG
AGCAAGTTGGGAAGTGGGAAAAATTGATGGGCTACGATTTCTGCGGACATGGAGACGTCGGGAGGTACGGATACATACGTGTAACGCACTCTCTACAGTG
AATCGTCACGACAAATTGTCGGACAACCGTGGCGGTGTAGCTTGCGGTAACCAGTGGCCACCATCAACATGTACCGTTTTCTAGCCAACCGATCGTACTC
TTAATCACCATCCCCGTGTTTGGCAAATAATAGAGAAGCGTTGCGAGTGCTGCATTTATCCGGGTGCTGCATGCATATAACTTTTGCGGTATTGGTGCTC
GATACGATTACGATGTCTGCAAGTTTATGCGGCATGTAGATATTGTGCGTTGCTGGGTCGTCTGCGGCTTACTGGGAATACATTTTTTGTTTGCTGGTGG
TGGTGCAATGAAGGCCGAGTCTTTGTCGAGAATAGGTGATTCTTTTGTTTTGATACCAGTTTGGTAGATCAGTTGTCGCTGTCGCAAATACGAAGTTACC
GTCTCCGATAAGTCGATAGTTTCACAAGAAGAATTGCGCTTGGGTATCGCCACTCAACACAGAAATGATGGATGCTACAGTCTGCTGGATCCTGAAGTCC
CGCGGTACCTCGACATTGACAGCGCTTTTGAAGCACTGTCGATTCTCATTCACCAGACTCATGACAGAATACTTGCAAGCCAGTGTCTGCGCGGCTAGAT
CGCACAGTGTATCGTAAATTCCACTTGCTCCTCTGTGGTACCACCAGCGTTCTTCTCGCGACTGTTTAGACGTAGCCGTTCCTCCTATCCTTGCTCTCTT
GATCGCAGGGTGCAAGCTGCAGTAGCCAAGTAATGCCCACAATGTTCGGCATCGCAGACACTAAACCCCTGGGAGCACCAGCAAGTACTCTTCCACCGCG
TCGCACATTATTGTGTATTTCTTCAGGCAACACGACGCCATCGGCTGTCGCTCTATTCACCGCGGCCACAGCCGCCGTCATGTCGGCCTCCTCCTTCTCG
AGACCCGCAGAATTTGGGCACCAAAGCAATTCGATCACAATACACTTTACCATTGCCAAGCCACGCCGCCCATATATACAGCTTCATTCTATTCATATCA
GGTGTTCCTTATTGATGCACATGACTGTACTTTGACTAATACAGATGTCCCCAACAATTTACCTCGCACAGGTAGCATGGAATTTGAAACTGGCCGGGAT
GGGATGTACTAAGATAGATGCAACTTGGACAGGAAATGCTGTGCTGCGGGAAGCTTTCTGCACATGCAAGCAACACATTCAGAGTAACTTAGTACTTTTG
CATCTACCGGTATAGTACACCTGTGCAAAGTTGCCGGGGACATCTGTACGTGTAGTAAAGGAGCATCCTTCAGGCGAATCGCCTAGGTTGATAGGGGGGG
GGGGGTAAATAGAAAGCAATGTACAGTAGTATTTTTATACTATTAACACTAAATGACTGAGAACCACATACCGGAAATGTCCCTTATTCGGAATGCGGTC
AAAAGTTGACTGCGAATAATCGTTCGATGCTTCTGCAATTTGGTCATCGTATCGACACTCACTAAACATTTAAAATGGTGGAGCCCGTGTCCTCAGAATC
GCTCTGACGTGCAAGTTATTGGAGCACAAATGTCGGTGCCGGCGCGTCCAGGAGGCATTTTGGCCGCAGCTTCTAGTGTGAGCCCGGCTTGATTGCAG