Description :
From Genome Similarity Track
Location :
Scaffold_130:80336- 88745
Sequence
8409 bases(100 bases per row)
TCAAGACCGTACGCCAGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCG
CAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTTGGATCATGCGGAAGGCCTCGTCCAAATCGGACGAAGAGGCCCGGCGATTCACCCGCAGATA
CAGGCTTACGACCTCACGCTCCAACAGGTTCAGGCGGCTCGTAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCACCAGGCCCA
AGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGCTCTGTGTCGGACCCGCAGGAGAAGCACTCGGACGGGAGTGGC
GTAAGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGTACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGG
AGCAACGGCGTCGCGGGTAAAGCGACAGCTCCTCGTGAAGAGGAGGGGTTATGCCCACTCCGAGAGCTCGTGGGAGCCGATTGAACGGCTCCCTGATTGA
CTGCCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCTGAACGGGGTACGGACGATGAATACATT
CCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCACTTCAGGATGTCCCTTGGTAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGAT
CACGCTGGTCCAGGATGCGGGACAGCAGCTGGTCTTCATGGAGCTCCCGTAACTTCGTGGGTGAGTACTTATGCGCTTCCACCCACGCCCAGAACATGTC
TTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTC
GTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGTAGCCTCCATGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTT
CATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAACCCCAGAGCTCTCCTCGGGAGGCCAATA
CCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCTCCGAACCCCCACGCACACGCTGGGCAGCTTGGAACTCCTCCTGCTGCTGGTCGAGG
TCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATACGAGAAGTCGAAGATACTCCGAAAGG
AGCGAAGAGTCTCCTTCTCCTCGCGGAGTGGAGACTAAGAGGCGGTACGCTTCTTTGAGGACTTGGCGCCTTCGGCTTTAGAGGCCTTAGCACGCGCAAG
ACCCTCGGCAAGCGAGAGATGTTTGCGAGGATTCTCTTCATCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTGTCGGCCGGACTCTCAGAGCGCACA
GAGGTCCTGGGACTGTGATCACCTTGATTACTAGCGAGCGACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCCCCCACAGAGCCCG
CAGAAGCATCGTGCGTGCTCTCGGACTCGGCTTCGTCCTCACTGCCAGAGTTGAACTCACATTCAACGAACCGAGGGTTCGGACGATTGTCTGGAGAGGC
CGAGGGCGACGGGCTGCGGCGCTTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGATGAACCAATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGT
GCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCA
TGATAACGGTCGAAGTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAGCTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGACCAAGTC
GATGGTTTTCGACTTTGAGAATGAGAGTTTGTAACGTACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTAC
GTAGCCCTAAGTGTACCCTGGCTACATGAAGTGTGACACGTCATACTTCGGGATATTTGGTACAAGGTACCAAGGTCGTCCGAAGCCAACCATTGGCTGA
TGACATTGCTTTTCTATAGATCACTTATAGTTTGTATTTAACCCAAGCTTTATCTACCTATAAATATGCTCAGTTTACAATCTACCTTATTTAGGTCACT
TCGCCCTCTTTAACTAAAGAGGGGACCTGTGAACTGCCGTTCACTACTAAACTGAGAGTTTGTATACTCTCGGAAAATAACTTCCTCTAGCGCAAGGTGC
TGTGTGACCCCGTCACAGATATGGTGAAGCTCTTCTGCGCGATTGTTGGTATGGCGGGAAGCGGAACAGGGTCACCGCAACCATACTATAACAACCTTAA
CGACTAAAAGCAACCATAGTGGATGGTAATATATTGTAGTCGCCAAATAATTTACGCAGCTCATCGCTGGATTCTCTAAAAAAAGAGATGGAACTATTCG
TGTATTCCACACACACATTTTGTTCAAAATCACATCTGACACTTAGAATTTTCACAGCTCTGAGTGCCTCAGATGGACGAGAAAACATTGGCGCGCGAGT
TGGTCCGCGCTAGACTTGACGAGCTCGGGGATATGAAGCAAAATCTGGATACACTGAACAGGGAACTGGGGAGGCTGCTGAAGGCTCAGCTGAAGCTCCA
CACCTCGATAGAAGACAGCAAGGAACGCAGTTACGCGTTAGCAGCAGCTTTGAATTACAAAGACGAAACTGCCCAAGATTGTGTTTTCTCTTTTGGGGTT
TTGTTGGAGATGGTGGTCAACAAATTGAAAGGTTAAGGGGAGCGTTTTGAAAGGCGTTTGTATTCTTTTATTCAACAATTCAGAGCCATGACTTATTTGA
GTTCATCTTCCAGCTTTTTATTGATCTCTTTAGTTGTTTCAGCATCGGCTTTAGACATAATTCGCTCATCGGAATGCATCATAATGACCCAAAGCATTAG
CAAACGCATAACCTCGACATCATTCTTCGAAACGTTGTAGCTCTGCCGCTGCATGTTTCCAGTAAGATAGCTGTGGGCTTGAGCCACCACCAAAACGCCA
CAGCTAGATCCGTCTGGCTGCTCAGGAGCTTTTATCCACTCGATTGGATTAATTTTAAGAGGGACATTATCCGCTGTAGCGCCATGCCGTCGCTCAAGAA
AGCCACGAATACCTTCTTTTTTAGCAATATTCTTCTCGTCATATTTTGCGACACCTTCTTAAACTACCTCAAAATCATCATGGTATTCCTCATCAATCAA
AGGCTCGTACATGTAAACTTGCACGCGCAAAATCTTCTTCGGTGTCTCCACATAGCTCAGATAAATAATAATGATGCCCCGGTGGCTCACTTTTATGCTC
ACAGGGCTGATGGTGTACTCGTACTCTCCCAGCGGTGTACTCGGGGTCCTCGGCCATCCCAATACCCAAGAAAGCGATGATAACGCGAGACACTTCTCTC
TCGATTTCACTATCATTTGCAAACAGAAGTCGATAAGACTGTCATTCAGCCATCCTCGGCATAGTCCATGTTGGAAACCGCATTCAGGTTAAAGCAGAAT
GAGTTCTTTAAATCGTCTTTTGGAACTAGCTAGCAGAGTGATGGTCAGAAAGGCAGCCCAGTGCGGAATCGCCGCACTGCTGCCAGTCCAAAAGTTTCCT
TTAACCCAACAAGTTGTGTGTGAGTGCGTTAGATCTGCGTTCTGTTGGGGTTCTGAGCCCAAATACAAGCAACCTACAGCGCTTCACGTTAGTAAACGAC
ACTCAAGCAACAAGATGTCATCCTCAAGCGACTCCGAAGACGACCGACACAGCAGAAAGAAGGACAAGAAGTTCCACATCAACTCATCCGGATACCCCGT
GAACTGGGGGGGGGGATAGAATTGGCCTTTCTACAAGAAGACCATGGTGGTGGCGTTCCAGAAGAGCCTGCTGAAGCAGTTTGCTGATGGCAACGTGACC
GAAGACGCTTCGTGGAGTCAAGACCAGAAGGATGAGCACACGGAAAAGCAAGCGAAGATCCAGATGCTGATCTTAGGCTCGCTGAAAACGAGGCTCGCTC
AACAGCTGATAAACCAGGAGACTGGGACCGATATGTGGGCGGAACTGTGCAAGATCTACGAAGGGAAGAACAACGACACCACCAAGGCGCAGAAGGTGTA
TCGCCTGCAGGGCGAGCTGCACAGGACTCACCTGCGCGCGAATGGTGACGTGCGAGGGCATTTGTATGCGATCTTTCACATTAGAAACGAACTCGCAGAG
CTCGGATCACCATTGAGCAACCTTAAGATGGTCGACATGCTGCTGCGAAGCCTGCCAGCACAGGTTTGCTACAACGAGCTCCGTAGAAAAGTGCTATTTA
GCTCGAAGATGAGCAAGTACACACCGGATCTTGTACTAGAATTGATTCTCACCGCTGAGACTCGCCGTAAGGACTGGGAGAAAAGTGCATTTGGCAATAA
CTAAGGCAAGAAGAAGCAAGACAATGCTTCTAGCGGATATAAGAGCAGTCAGAACAAGACTACTGGAGATGCAAACAAGAAGAGAACGGCAAAGGCAGAC
GTCGAGTGCTTTAACTGCGGAGGTAGGGCCACTACAAGCATCAGTGTCCGGACCTGGAGGACAAACCCAGGGAGAAGAAGAGTGCAAAGGCAAAGATGGC
ACGGTCTGATGTCAAGCCCGCGGCTCAAGTTACAGCGGATGCGACCGTTGAGGATACACGCATGCACAAGCGTGACGTGGTGTTGGGAGAAGTAGTGAAG
CGAGTGGCGAAGGACTACGATTCCAGTCGTTGGTATTTCGACAGTGGGACCAGCGCCCATATTGTGGCGAGCAAGGAGTACTTTACGGTACTGAATAACA
TGGAAGACAGCGACTCGAACCCGACAATTTCGGGCTTCGCGGACGGTGTCGACGCCCAAGCAGAAGGCTTTGGGACGATTTTGCTCGCGACCATGATAGA
CGAAGAGATGGTATTTGCTTTGTCGAAGACGTGTTATACGTGCCGAATGCTGGTTGTAACCTGTTCTCACCTCGCCAAGCACTGGAGCAAGGCTTCAAGA
TGTCGTGGGATCAAACGTCACTGCTATTTGGTATGTCGAAGGACAACACGGAGGTAATTCGAGCAAAGCATGAACATCGACTGTGGACATTTGACGCGCA
CAACATCGGTGGTGTTCAAGTCAACAAGAAGTCTACTGCTGTTAGGAAGCAGGTAGTGGCAAATTTTGCGGTGATGGATGGAGTTGAGGACATCGACGTC
TGGCATGCGCGTCTGGGGCACACATGCCCGGAGTACATTCGTCTTCTGGTTGACCGTTGATTGGCCAAGGGCATCATGCTGAAGAAGCGTGGCAAGATGG
ATTGCACTGACTGTCATTTCGACAAGCAGAGACGCAAAACCTTCCGGAAGAAGTTGGAGCGGAACATCGAGAAAGTGAACGACTTAGTGTTTGCCGACTT
ACTGATACCTGGACTTCACAACGGCACACAGTACAGTGCACTGTTAGTCGTAATGGATGGTTTCTCTCGTTTCATTACAACGTTCGAGGACTGAAGGCGA
GGTGAATGGATACATGAAGCAATACATTGCCTGGGCCGAGCGGCAACACGGACGTCGTGTTGATACAGTGATCTTTCGACGGTGGGATGCTGCAGCTCGT
GACGAGAACGATGCCAACATTGGGCCAGTGAAGCAAGTTCTCACGGACAAAGGCAAGGAATTCTGCAACAACTCAATGGAGAGCTGGTATGCTGAGAAAG
GAATTGTCCACACGAAGGTTGGTCCAAAATCTTCACAGTTGAATTTGGTGGAGAGGACACATCAGACACTGATTAACATGGTCAAGACTATGATGCACGA
CTCAGGGCTTCCGAGATCGTTTTGGACGCATGCTCTACAGACTGGGGTATATCTAAAGAATCGAGTCTTCTGTAAGGGAGCAGGGCGAACCCCGTACGAG
ATGATGTACGGCACGAAGCCAGATCTTCATCACATCCGCGCGTTTGGATCTCTGGTGTACTGTCATACACCGGCCGCAATGCGCAAGAAACTAAGTGCGA
GCTGCAAAGTGGGGTTTTTGATCGGCTATCAAGAAGATGTTATTGGCTGCCAAGTGTACTTCCCTACCGAGTATCAGAAAGGCTTCGTTGCAGATGTGAA
GGTAAATGAAAACATCAAGTTCAAGGACCGCTATGGAAGTGCCTTCAAGTCGACGTTGAACACGTGGGTGCAGACTTTCGATGAGTTTGTGCAGGATGGT
GCTTTCGATAATGTAGAAAGTGATAGTGATGAAGCGTCTCAACAAGCTGAGTGTGACGCAGAATCCGTGCGAGCTGATAGTAATGTCGACACGGAGAGTG
TGGCTACAAGCGACGGCCTTGATGTTGCTCAAGAAGCTTTGTGGGACAATATTGTGGAGAGCAGTGTACTACCCAAGTACGACCAGCCATCGAGCAACAC
GCCTAGCAGTACACTGGGTGAACGTGACGAGCGATTATGGGAGGACATCCTAAAGAACAACTCGCTTCCAGACTACGTTGATGCGTTCGAAGATACGCAG
GAGGGCGAAAATACAACCATTGTTGAGCATTGTGCTGATGGAGGTTCTGGCGAAGATGATTCCTAAGTTGATGAGGATTCTCAAGCTGATGACGACAACA
ATAATCGCACGGCTGATGTTTCTCAGATGGAAGATGGAGATTCTCTAAGTGACATTGACGCAGAGTCGGTAACTGAATTTGATGAACATGATGGGCATGA
GTTTGATACAGATGATGGACTGGACGTTAGTCATGTGTCGGATTTAACACCGGTAAATGATAGCGAGGAGAGCGAATGCAACGGCTACGACTGCGACCCG
AGTGACGAAATAGATACCGCCTATGAAGGCATGAGTGATGAAATGAATGATCCACCAGGACCCGGAGGTGGTGTTCTCGCGTTTCCTCAGCAGCTACTAG
TGGGCAAGGTGCATCCGAGAGATGAAGAAGTTCGCCGTGCGCAAGACCGGAAGCGTACCAAGGTCGGAGCGAAGCGTGCAACAGCAGCACGACGACCAGG
ACTGCGCGAAGTTCCAAATACTCGCAAACCTGAACGATACGAAGACTTTGCGGTGTATTCAGCTTTCAAGGCACTGCATGTAGATCGCCGTGACAAAGGT
GGATTGCGCGCAAGTGACATCAAGATACCACGAAACTACAGAGAGGCAATCAGATCAAAGCAAGCAAGTTTCTGGAAGGAGGCTATGGACAAGGAGATGG
CTTCACTGAAGTCCAAGGACGTGCTGTTGCAGATTCCAAGAACAGAGATGCCAGCAGGACAGCATGCTATCAAGACTATGTGGGGTTTTGACGTGAAAAC
CGATCGTTTAGGATACATTGTGACCTTCAAAGCACGTGTCGTGGCCCGAGGAGATAAGCAACGTTTCGGAATCGACTTCACGGACACATTCTCACCGGTT
ACACGCATGGCGACATTCAGAATGTTTGTCGCGGTATGCATTATTTTAAATCTAGTGATCTACCAGGGCGACGTAAACACAGCGTACCTCAATGCTGCGC
TTGGAATAAAGCAGTATTTGGATGAAGTCCAGGGCTACCCGTGCGAGGATGCCGGGATGATGTACATCATCAACAAGGCACTGTACGGACTACGCCAGTC
CGGAAGAGAGTGGAATTCAGAGGTGAATAGTTGGATCGTGAACTATGGGTTCAAGCAGTGCGAGACTGAGCCATGCCTCTATTTTTACGACAAAGATGGC
GAGTTTGCCATGGTTCTCCTCGATGTCGACGACATCTTGTGCGCGACCAAGAGTGAAGAATTTAAGAAGAAAATGTTTGAGAAGCTGGACAAGGACTATG
GTTTGAAGGACCAAGGTCATCCAACACATATTTGGGCGTGCAGGTGGAACAGAGTGAAGACTCCATCAAAATACACCAGACCAAGTATTGTGACGAGATT
ATTGAGCGCTTCCACTTCAGTGGTGCGCATCCCAGTAGGATCCCGATGGAGACGACTTTGCGCCTTACCGTGAAGGACACTGACACAAACCAGCGCAAGC
AGGTGGCTGCGAACGGCAAGAACTTTCCGTATCGTGAACTGGTGGGGTCGCTAATGTACCTGACGACCTGCACTCGCCCAGATCTAGCGTTTGCTGTTGG
CCAACTCAG