Description :
From Genome Similarity Track
Location :
Scaffold_1445:8033- 9681
Transcript NameFunction/comments
Phypl_g13427hypothetical protein

Sequence
1648 bases(100 bases per row)
TGCCGGGCGGCAGGCGGATGACTGCTGAGCCGGCACATGCTCCACGAAGGGCTAAATACCCAACTTTCCGTCAAAATAGTGCTGTATGGCAGGATCGTAG
CGAGGGCGCACCACCGCAGACAGAAACATTACACGGGTGCTGTAGCGCTTACTTCGCAAACGTCGCACCGGTGCCGATTCGTCCGACAGCGGCAGAAACC
GTTTGGTTGGCTGCGCGATGTAGAAAAGCTTCGCGTCGACCTGCACGGTAGTCGAACATCATCATGTCTCTCTGGATATGCGATAGAGAAAACTGCAAAC
GATGGAACTTGTTGGCGTCCGCCAGTAGCGGcttcgagacgctcgtgTGCTTCCGTAGGTGACCTAGCAGGAGCTACCAGAACAACATGGCATGCGTCCT
ACCGCATGCCGCCGCAGCTGAGCGGACGGTTGAgcgctccacgacgtcgatcCCACACAGGCGCTCGAGTGTTGCCGTGGCGTCGACCGCACGGCGCCCG
CTGGGAAGCCTCCGTGAAGGCGATGCGAAGCGGCCAGtgcgcgccgcctccgtccTCGCCCGAGTTCACAGGCGGGAGATTATGGAGGGATGATTTCCGT
CTGCTACAGCAATGACAGAGAGATCCCCGTGCTTGAGACGGCCGTTggtggagcgcagcagcaaataggcgaggacctgctggcgctcatcGTTGGTCAG
CTTGGTCTTGCGGGTGGTGGAGGGCTTGGCCATGGTGCGACGGAGGTGGTGCTTGGAGCGAGGGTGGGCGAAATCGGTTGTGATAATTTATGTACGGTAT
GGCGGCGCTGCTAGGCCAGCTATTACAACTCCCTCAATACTTGTCGTCAAAGAAAACGGAAGCCATCAAATGAATGGTGACGAGTTGCTCATACCTTGTT
TTGCGATGATCTGGAGTGAAGCGTAGTGACTTTTGTCAATTGTGCTTTCTTTCTAAAACGGAGTAGTTTTAATATTTCAATAGTGTGATACCAAAAGGCT
GCCAACGGGTGCCGCCCAAAACTGCCGTATGGGAGTGTCATATTCAATCTCTGAATTTGTCTCTAAATATAAAAGTCGTACAGGTACAATAGAACGCTTT
CTAAGTTCGCGATTTTCTGGTTAAAGACTGGATAATTTACTGGGACCAACTTTCAACCTGCCGGGACACCATGCACTTCGTTAAAGATTAGCGACCCAAG
GAACTAATGGCTGTTCTCTGAAGAGACAAATCTTTTTCGGGGGAGCGCGCACATCGTGAAAACGTCAATCTCTCGGGAAAAAGCAGCTTTCCCAGCGTGA
AAGCGGTTCATTTGTCGATTTACGTAGTCTCTTCCGAGTCCACATGTACGACATAGTCAAactgctacatgtagtacttAGTAGTAAGGGTCAACCGAAG
ATCTCGAGCCGATCGTGAACCGGCGGCTCAAGCGGCGCCAAGGAGATGATAAACTTCTCGTTGCGCGAGTTCAACGAGCTCTGGTTGTCCGTCCGTGACT
ATGCAATAGCTCGCTTCAACGTTGGCAGAGGTCGTCGTTCCTCGATCATAGGGAAATATGCCTTCTTCATGACGCTCGTCACCTTACAATCAAGAGGGAC
ATGGGATGATCGGAACAAGATCTTCGGCCTAGCTACAGCTACGTTTAC