Description :
From Genome Similarity Track
Location :
Scaffold_13:80311- 85111
Transcript NameFunction/comments
Phyra_75456Hypothetical protein
Phyra_75457pantothenate kinase putative
Phyra_41102pantothenate kinase, putative
Phyra_75459phenol acid carboxylase, putative

Sequence
4800 bases(100 bases per row)
AGGCAAATCGTTCCTGACCCGGCGAAGTTTCCTCGCTGTAGCCTTGCAAGTACTACACAGTGTACTACACATGCATCTCACTCGGACCAATCGTATGCAT
GTCGGCCTCGGTGCCAGCGAGTCGATGCACGTGCAGTGTTGGCGATGTCAATTCTTGTCAACAGCGGAGCTCGTTGTTGTGGGTACTGGATCCTGGAGAC
CGGCTGGATATTCTGCTGATGGCACCACTCCATCTGGCTGCAGGTGATCTTATCGCTTCAAGCTCGAAGAGCGTTTACGGCAGAAAGAAGGCCCCATGGG
TAGGGGCGATAAATTACTTTGTTATAATACTCGGAGCCCACCGGCTTAGTGTCCGTAATCACCAACCTGCAGGAGCTCTTGTCTATTTCTATGGGGGCCT
GCTGTCCTTCACATGACCCGCTGTCGTTTGAGGGGGGCTGGACCGCACGGGATCGAGGTCATAGTGCGGCGCTCGGCCTCGACGGACTGGTACTTGGTCC
ACAGGCGGGTGAGCATAGCCTCCTCCTGCTTCCGGCGGATGTAGCTGCTGGACGGCGGCAGGTTGGCAACCGCGAGGCGTTTGGGGGTGGCCGGCGTGGT
CTCGGCGAACAGGCTCGGGTCCAGCTCGTTTAGGTACTCGTCGAGTCCTCGGATGAGCATACGCTCGGCGGGGCGGCCCTCGGTCGGTTTCTGTTGCTGC
TCGAGCTGTTGTTTGCGCTCGAGGAACTCCTGGATCTCCTCGTAGTAGCTGCGCGAGCGACTGTCGTGCACACCGAGCAGCAGACTCGCGTCCTCGTCGA
GCCCGCCGACCTGCGCACTGATATACTGCTGCACGTGGTCCATCTCGGCGCGGTACTGCTGCTCTTTGGCGGGCGACGCGAACTGCAGCGGGCGACGCAC
GATGCGGTGCACCGGCTTGGGCGGTGAGCAAATAGCGCTGCTGCTGCTGCTTGACATAGGCTTTTCGTGGCTGGTGGTCTGCAAATAGCGGAATGGACCT
TGACTGCGGTGGAGCTGCTCGGCACAGAAGTCTCACGGGTGTTACTATCGCTTCAAGGAATGGGATCGCCCATCACTCCGAGCCAAAGACGACGCGACAA
CATTAGGTACCAATCAGGTGTGGTGGATTCTTTTTTGGTTACCTACACCTGCAATATAAGGGTTTTCGGAAAGCTGAAGTGTATTGAACTGCCTAATCCG
TTTCACTCGAGTTCAGCAGGGTCATAGGAAGGTAGAGTAGAAGACACTCACTCCTGCGCTGCGTCATCTGGTTCTAAAAAATCGGGAAAAAATAGTCGAA
ATTTGGTCGCCGACATACAAACACCAAATACACCGCCCTTTCGAGTAAAACGACCGCGACATTCATCAGCAAAGCCCGCCGAGCTGGATTGGCGCGCAGG
ATACTTTTGCTATGTTGGTGGTGATCCTGGTCGCCTCCGTTGTCGTCGAGCGTGGGTTCACTCTCTTTACCTGGTTCACTCCTTGAGCAGCGCGAACAGA
TCGGATCGGGCGAGGTGCCAGCAGCGCGAGCAGATGGTTGCACCGGTTGACAGTCCCAGAACAGCGGCTTGAATCTTCGGTTGATTTCATGTTTTCAGCG
ATGGGACCCGCCGTTCCTTTCAGTGGCAGCTCCAGGCGCTCGTGGCAGATCACAGAGCAAAGTCACATACATGTACAAACCGTAGTTGAAGCGCTGCGTC
ATCGCAAAATGCCCTTGATTCCCACCGCTCGACATGTATTGGTCAAAACGCTCATCAGTAGCTATTTCGGCCAATCCGACACCACTAGATAGGAGAGCGG
CCCATCAGGTTCAATCACCTGCAGTAGCATGGTAATGCCGACGCTGGGCAGCGGAGCCGCAGAGCGCGCGCTGCTGGCCGGCGGCTTCCTGCTGCTCTCG
TCTACCGTGGCGCTGTTCTGCCTCGAGCGCAAGCGCCTCCGCCAGCGCGCGTGGCGCCAACGCCTCACATACAAGAAGCTGTCGAAATCGTGCGGATTTT
CCCTTCCACTTGTCGTTCCTTGTCCGCCTCTAACCGCGTCTGAGTTACCTGCAGATCCGACCTGGGCGCGTCCTTCGGCTTGGACATTGGTGTGAAAATC
CACTGCAGGAGCTGATTTGGCGCTGGACTGACGCTGTTTCCTTGGCGCAGGGGGAACACTGGCCAAGATCGTGTACTTCGAGCGCCACGAGGCCGGCAAC
GACAAGCGCAAGAGACCGCGCTCGGCGTCGCTGGATGTGGCTGCGGGGGAGATGACTCAGTTCCTGCGCGAGAACGAGTCGTTCGGACTCACGGGCGTGC
AGGACGTGCGGCTGCGGATCCACTCCAAGACGCTCAACGGGGTGCGTTGTTGCTCTGTGGCTGCAGTTCGTGGAGAGTTTAGAGACTTATTGGCTGGTTG
CAGATGTTCCACTTCGTGCAGTTCGAGAGCAACAAGACGCGGGAGGCGATTGAGTTCATTACCAGCAATGGGATCAACCAGTCCCTGCGGATTCTGCCAT
GTACGGGCGGTGGTGCTCACAAGGTCCGGCTTTGGATTTTTACCGTGGAAATTGGAGCTCACTGCTGACATCTCGTGTTCTGATGGTGGGACTCGTACAG
TATGGCCCTGCTTTCAATGAAATTGCGGGAATCGAGCTGGAAAAATATGACGAGATCGAGTGCACGATTCTGGGCCTGCATCTGCTGCTCACGACACTTT
CCGATGAAGTGTACACATTTGAGGTATGTACTACTCGGCTAGTTTGTAGCAAAACAAGACTAACGCGATCGTTCTGTTGCTGAGTAGGTCGTGGATTTTA
ATTCCTTGACGGCGTCACGGGTGAAAACCATCCAGACGGATGTGAACGAAGATGTGTACCCCTATCTGGTGCGGCTAATGTTCACAGTTACCACCCAAAC
CAAAAAAGCTAACTCGAATTGTGTTTTTGCTCACCGCCACAGCTTGTCAGTATCGGCTCGGGTGTGAGTGTGTTGTACGTGAAGGGGCCGGGTGATTATG
AACGTGTCAGTGGCAGCAGTATTGGTGGGGGCACATATTGGGGTCTTTGTCGGTTGATGACTCACTGCGAGTCGTACGACGAAGCGTTGGACTTGTGTGT
CCATGGCTCCAACAAATCGGTTGATATGAGCGTGGGGGATATCTATGGTGGGGCATACGGCAAGTTCAAACTACCAGCATCCACAGTCGCCAGCAGCTTC
GGGAAAATGATCTCGGTTTCTCGCGAAAGCGTGAGCGATGCTGATCTTGCTCGCTCACTGCTGGTTATGATCACGCAAAACATTGGCCAGGTTGCCTTTC
TGAACGCGACATTGTACAAGACCAAGAACATTTTCTTCGTTGGAAACTTTCTTCGCCACAACAAGATTTCATCGCGGACGCTAGCGTACGCAATCAACTT
CTGGTCTAATGGAGCAATGGAGGCACGGTTTTGCAAACATGAAGGTTATCTCGGGGCGCTGGGGGCGTTCCTTCGCCACGCAGAGGTAACAAATGCCCAT
GGCGAAGAGTTTGTTTCGGCAACACGAGGATCAAGGCAGTTGTAGTCCTGCTTGCGCGATTGAGGAGCGCCTCTGCAGCTCGATCGATGCATATCAAGCG
AGGGTTCAATTCAAATAGAATTGACGACGTAGACTTGCCGTTGAGTGCCACGGTAGTCTGCCGAGTTTTGTGGGCAAATACTGTGCTAAGCTTACTATCT
GTTAGGTACTACGGGTTATTCAAGACTGCACGTACCAAGACTGGTCTGGTGCGTAAGTAGAAGGACAGGCATGGCAAGTGGATGACGAAAAGCTCAGATA
TGATGGTCTCGTGCGCTTCGTTCACATGGTTAGAGAGGTTCCACCAAACGAAAACAGATCCTTTCATGCAAGAGCTACGCTCTTCATCACTAGCGTCGCG
CTTTAGCGCACCGATCCAAGTGATCAACGCCCTGAAAAACAGCACACAAGCGCCTGCACGCCTTGGTGGGTCATTCGCGTCTCGGTTCCGTGCAGCGACT
AGCCTGTCAAAACCACTGGTGAGGCCACCGCTACCGAGCAAACTCGAGATGATGAGTGCCCGGCAAAGAGGTCTGCTGGGATTATGGGCCTCATCTTGGT
GGATTGCGCGTTGGCGATTATCGCTGAGTTCACGAAACGCATAGACATGACCTGGTGGTCGATCCTCCAAGCACTCGTGACGCAGCAACCTCTCCTTTGA
TGGGGTGAGTGAGTGAGATGGCAGGTGGCCGTTGTGGATCAAATGCGCCGACATCAAGACGATCGAGCCCAGCACTGGTAGTTTCATTCTGCAAGTTTCT
GCCAAGTGACCAAGCACCAACCCAGCCCAATCCACCATGCCGCTCACCGTCCCTGGCTTCCACACCAACACGCCGCTGGACGCGACGTTCGACAAGGACA
TTCGTGATCTGCACCTGATCTACGACTACGACGCCGAGTCGGAGGATGGCAAGCCGGAGAAGTGGCGCTACGAGCTGTGGTTCTTCTCGCACGACCGCGT
GGTGTACGCGATCCACGGCGGTCCGATGGCCGGCCGCACCAACTACCAGACGTGCTCGTACCAGTGCGTCCGCCCGGGCGAGTTGTGGCAGTGCAACTGG
CTGGAGGAGACGGGCACGATCGTGAGCCTGGTGTTCGACATCAAGCTGCAGAAGTTGACGACCATGATCGGTTTCTCGAAGGGCCACTGGGAGCACCCCG
TGGAGGCCCACGGCGACAAGCGCAACGCAGAGGACTTCGCTCGCTGGCGCAAGCTGGCGGACTACGGCAACCAGAAGGACCGCCTGCTGCTGTGCGAGCA