Description :
From Genome Similarity Track
Location :
Scaffold_527:8031- 9833
Sequence
1802 bases(100 bases per row)
GATAATGTCATTTGACCTTGCCGCGTTGCTCACAACTACTGATCCTATCGTATGCGCATCAGTATAGCAAACCCTATTATATCACGTCGCGCGGCCATAC
TGTTTTAATTCTAATGCCGTCAAGTTTCCACAGCGATGCGCCTGTCTTAATAAATGAGGTATGAATACCTCCTTGACAAGTTGATCAAGTAACAGAAGAA
TTTTTCGTAAAATTGGAATTGCGTGCACGTCTTGTAGCATCATTTTGGTTGTCTTACCTTCGATTGTAGTTGTCCTTAAGGTGTGTCCACACTATACTGA
ACGGTGCGCCCATCTGCAATAGTAACAACTCGATTGTATGCGCACTCGTCACAAAACACAAATCTGCTTCTGCGTATGTGATGACTAGAACCTGAGTTCA
GGAGCCATTACTGTTTCAACCGAATGCTTTTGTTTGCTATTTAACATGCCGCATACTAAATTTTCTTCAAAATATCTTATTTATCTCAAAGAATGCACCC
GCCATTTGCTGAGCCTATTGTCCTTTTCTTCGTTGGCAGAACCTTCTTATTATTTGGGCTAGTTAAAGCGATATGACCTTCATTTTCGCAGAAATATCAG
GCACACTTAAAATATTTCTTGACTCCTCATGCACTGAATGTACCGCCGATTCCCATGCACTAAAAACGATTTTTTCTGATCATTATTAGGGATTATCGCT
CTCTGCATCTTCGTACAGCGTGAAAGCCCCTTTGACTTTTAAACGTATCATTTTCCATTTCCTGTGGTGGATGTCAGGTACCGTGTAGATTTAAAGAGCT
CGAATTTGAACCCCAAGCTGTATTGATCGATCTTCACCAGCAATCTTCACTTCTCTCATGAGCATGAGTATGAGTAAAAGTACTTGAGGATAATCTTGCT
CGGATTAGCCATACATAATGCTCTCCACATCTCGTATGTACTCGATGTAAGATATACACGTCGCGTTGGGTTTCTTAGGTGCTCTGAGCAGTTTGCTTAG
TTGTGACCGACTTAATTTATAGCAGAACCGATTTTTCACGGACTTGAACACGTCTTAGAAAGTGCGACGTACTATGTATGTCCAAAGGAGTCACCGCGTA
AACCATTCGCCATGCCGCTCAGTCGGTTCTTTACGTTATAAATACCACGAGATCTAAATTTATTTCAGCGAATGGATATGAACGTCAGATTTGTACTCAA
ACGAGTCCCAATCTGCTTCAAGGTATGAGTGCTGCTCATCTGTACTGAACTCAATGACCTAAAGTCCTCACCTTTGAGTGCACCAACTGGAAGGAAGGCT
GCGGATGATGTATCTGGCGAGGCGGTGTGCATCGTCGCACTNNNNNNNNNNATTGGTTTGCCCGAAAATTGCGCCTGAGATCTCAGGGTACGAACGTATT
GTTGCAAGTTTGAGATAGGCTGCATCGAACAAATTTGTGTACNNNNNNNNNNGAATAATTAAAAGAGGAGAAAGGGAGTTTACAGACGCCAAATTTGCTG
TCTATATCTGTAATTACATTAAGTCGGGACACGCCGCCTCCGCGATGGTCATATTATATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTCGGCATTATGGTTCCTTTTGGGGTCCGATATTGTCCAGTGTCTTTGATTG
TGTAGCAATGTTTCGTGTTGGTGAGAAATTCCATCTTCTTCACGGACACCGGTTGAAATCATCAGATTATATTGATTTGCGACATGACCGTTCTCTAAAT
TT