Description :
From Genome Similarity Track
Location :
Scaffold_335:8030- 12308
Transcript NameFunction/comments
Hyaar_Emoy2813792histidinol-phosphate aminotransferase

Sequence
4278 bases(100 bases per row)
TAAGACTAACAGATTTGGCATGCCTCTTCTGACGTGGTAGGTCTTACTAGCGTTTACACTTCTTTCTCCGTGTGCTTTGTTTTCTTGAGGAACGAGGACT
TTAAATTGTACAATGGGCGCAAGAGCCTGTTGCGGAGTTGTATCACCCCACAGAACGTCATGCTGCTTCCCTTGCTACCCACCCGATCACGATTGCAACC
GATTGCGATGATGGTTTACTTGCCGCGATTGACAGCGTATTTCCGCGATCAACGAATTTAATACGTCGTTGGCATATTGTAATGAATTTGATCAAGAACT
GCCGCTAGCATTTACTGCTGAGGATTGGGAGAGTTATACAAAAGATTGGAATGAGGTAGGTACATACAGCGCTGTCAACTATTTCCCTTGCTTACTAATA
TTTTTTACCCTTTTAGATAGTGCGATCAGCCACGGAAGAGACATGGATACAGTCATGGGTTGATTTCCAAAAGAAATACTCCAAGAAGAAGAGGGTACTT
GACTACATAACTCGACAGTGGATCCCATTGATCACCCGCTTTGTCTCCGCATGGACGAATAAGTTTTGGCATGTCAATAATGTGAACACATCAAGAGTGG
AAGGAGATCATTCCGCATTAAAGAAGCATCTGAAGGTATCGACCATGGATCTGTGGGATGTTTGCAATAAGATTGAGCTTGCGTTGCTTAATTATGTGGC
TGAATTGAGAGCTGCAATTGGCGGTTTGCCATTAAAGTGTGGAATGATCATATAGACAATTTTTGTGCCGGAGTTGTTCGTTTCGTCTCAAGATATGCGT
TAGTGAAAGTCCACGAGCAAACGCTGGTGCTAGATGATCAAGCATTGTGTCGTCAACATTGCTCTGGAGATTTTAGCAGCACATTAGGGTTACCGTGCGT
GCACAATTTGCCTCGCGGAAGCTCTCGGGCGGAGTACTCCATATCGGTTACTTCCATGCTCATTGGCACCTTCGACGTGTAGGGTTTTCACGAAATTTAC
CAACCTTGCATCTAGATGCTGAAGGGATAATGACAGTGTGGCTGTAGAAGATCTCGTTCAAACTATGATATCAACTTATCGTTACCTGGCTCCCCATCAA
CAGATAGCCATGCACCACCAGATTGCAGAGATGGGGTTGCAGACATTTAGTTTGGCACATCCGGCAATGGCAAGATCGAAAGCCGCCCTAACGGAGCCAG
AAACAAACGCCCACCAGGTATTCTTACCAAGGGATGGAGATCAACTCAGAGAGAAGCGTCACAGTTCGAACTAGTTGAAGCGGCAGTTGGAAGAAAGTGT
GGTGTATGCGGCCAAGGGGGTACTCGGCATAATGCCAGAACATGCCCGCAAAGAAACGGGCGGGCATCTGGAAGCACTAGCGATGATGCTTACAATATAT
CTCAGCACTGACGTTTCCATTTCAATCTCCTGTCACTTTAGAATAAGGCAGATAGAAGTTACAGCTATGTGTTAATAGCGACAGTGCGGGTAAAACAAGA
GTATAATCCTACTTTCGAAATCACTTGTGATACTTCTATCGCATTGGGGCTTCTACAACGGTGGTAGTGATTAAGGAATTAAATAGCCTACGTAAAGTCG
GCAGCATTATATCGGCTAGTATATCGAATCATAAGATGTCTTATTTCCTGTTAACATGGACTTACTCTTTCACTTATCTTACGCTAGAAAAACAGATACG
ATCCACGCCGTAAAAGTCCGTGCGATGTAAATCTTAATCTGCATGCTACTGTATAGCGCGTACGGAAACAGATTATCGACGCAATCCGCAGGATCTGCAC
GATCACCAGCAACTATCGCTTCATATAACACACATTTATCCCACTCCAACGACTGTGAGTACTGCGAGAAACAAGACAAGCTGATTTAATGTGTAGTTCA
ATCGGAAATGATTGAGCTCGAATTGCTGCTCGTCACTGTTGCGTTCATCACAACTCAAATGTACCGGGCCTTTCACTAGCGCGCTCAATAACAGGTAAAT
GGCATGATGCCAGCGGGAGTCTTGTGCTGGTTCATCATCTCTAAGAAATTACATGCTATATTTAGACGCTTATTTCGAGTATCTGCAAGCTGGATTCGAT
GGGCTTGTCTTGCAACAGCGGTCCACGTTGATGGTCCACGTTGATGGTTAATGGTTGATAGTTCCCTGACATATACTTCAACACCCGATGGTTTAAATCG
TGAATCGCTTGTGATGATACCGTCAAGTTGCGGGCATCGCATCTCCTCTCAAATGACACAGGTGCTGTTAGCACATCTTGAAACAGAACTCGATGAAGGT
CGACATGGGTGTATCCGGCGGGTAACTATAGAACTTAATTGCCTGCTTAAATTCACCACAAGCTGCTGTAGCCATCATTATCGTTGAAGAGCGACAGTGG
CACTGTCTCACCGGGAAGGTTGGTGAGAATTTCTTGCATAGTCGAAGTCGGCGAATCGTTCGCCGTGCAGCAGTGTATACAGCTCGTGAAAGTAAGATAC
ATTTTTCATATTTACACCATAAATCTCCATCTCTTAAGCAGCTGTAGTGCTTGGACAGCCTCGCGCAAAAGGCCAAGAGCAACAAAAATAAACTGGGGGA
GCCGCGGTGTGAGCAAATGCACGTATATTGTGCTATCTGGACGATCATTAGAGCGCCGACAACAGATGGAGAACTTACCACAACGTACTGGAACCGTTGC
TCGTAATTAGGATCCAAGACGTAGTGTTCACAAATGACACACCAATGCTTGTGCTGCCCTGCAACCTGCGGTAGATCGTTCTCATACGCGAACGCCGCTT
CTTCCACAAGAGCAAAATGCTTTCGCTGTCGTACAGCGTAAAGCATGCGTTCCAATTTGCCCCTGCTTTTAACTGCCTCCGTGCTCTGTGAAACCCCGCC
TCCAATCGGGTCCAATAGAAACGCGATCACTGTGCACAATCTTGTTTAGAAACGTCGACTTGCCGACTTTCGGGCGACCAACAATCACCATCTTGAGCGT
TACAGCTGAACACGAGAATAAAAGACCTTATCAGCATATTATTGGTAGCCCTACATGCATCGTACCCGCTCCAGCTACGTACATCGTCCTGTGTAGTTGA
CGACACGACTAGCGCCTGATACGCAGGCATTAACGAGTCAAAATTTTATGAAAATAGGGCGTGCATTTAACAATAAATATTAATAATTTTCAAAAGGCGT
CCATTTAGTAATTTTGTGGGCGTGTATTTAACAATTGACTTTATTAATGGTATCAACCAATAAAGACAGCCACAACTGAAGAACGTAATGAGCGGTGAGC
AGGCAGTTACAATACATGTTTGTATTTAGATATGGGAATGGTTATCCACTCAACTAATTTTTGCTATCCGCACACACCCTCAACTGGTATTCATAAAGTA
CCCATCAGGGATTGGCCCATTTATAAAAATCACTTATTAACACAATTTTTCAGCTCTATATCGCGTTTTACAATCCCCTACTAAAATGGTATGGTTACCC
TTAACAAGCAGTCATATAGCCCCTTAAATATTAATATTGTACCTTAGTGAATATTATTTTGATGTTATTTAGCAACACTTGCTCTGGAGGATGCGTACGA
TACTCTTGCTGATGCACAGATCGCTGTACAGAAAGCTGCTAGTGTAGAAGGTTTTTGCGTCGTGTCGCTCCGAAGTAAAACCGATTGGTCGAAGCACAAA
AAACGGTTTGGCTTGTTTGCAGCCATTTAGAAAAGTGTAGGGCGGAAGGTCATGGTGTTCTCAACTAAGCACTCATCTGCTTGTTTTTGCTCATGGTGCA
TCATCGTACGGAAGGGCGGGGAAGAACGCTGATTAAAATCGAAACGAAATGCGCCGAACCCAATTACGAGCGCATTGACATCGTTGCATCATTTGCGAAT
ATAAAAAAGCTGTCTAAACAACAAAAACTATCCCGAGTCGCATCATATCCGACATCCTTGGTTGCGACAGCAGTACTTGCATCTTAGCGACTTCCCCTGA
AATTCTTGCCATGCAAGAACATCATATATTATAATTTAGTTAGGGCGACAATCGAAGAATAGACAAATGATGTATTATTGAGTGAAATAAATTCCAAGAC
GTTCCGCTTAATTAGACAGTGTACCCTGCGTCTGTGTACTTAAGTTTTTAGAGAAGGCTGAGGCTATCGGTATAAAGCTTATGGTTACTGGTATGAAGGG
GATAAGCGGGTGCAAAAATTTGTTGTGTGGATAACAAATTCCTTAGATATAGTTGTAGGAAGACTAAATAGGATTTAT