Description :
From Genome Similarity Track
Location :
scaffold_3:8030- 11041
Transcript NameFunction/comments
Plaha_PHALS_12651atp-binding cassette superfamily

Sequence
3011 bases(100 bases per row)
gcactattacttggttcttgtaacgaACggaaggtcggagacctaaagacgcttcctcaagcgcaaagctacggcagccccgctgcacatacTGCTGTAT
CGTCCGTATCGTAGTACTCTCGAAACAACGTGCCGTATAAGTCATGTCTACCAACTAACCATTCTTGGAAGTTGTCTGCAAAACTAGCTTTAATGACCGA
CGTATTCATTGATCAGTGCCACGACTTGCGGACCCACGAGCACACCGATTTTACTGGCGATGGTTTGTGATTGCCACATAGTTGTATGCCGCGCGGTCAC
TCTGCTTTCACGTTGATTTCAGCATACAAAAGCAAGTTAGGAAGCAGTCACTAATAGTATTAAAATACTGTCACACTTTAGCACAATTCTCGTCATGTCC
TCGAAAAATAAATTGGTATGCATAACGCCTACGATGCATCACGGACCTCTGTCGGAGTTGTCTTCTCTAGAAATTTTATGCTCTTTTGTAAATTTGTTGT
CATTGCGACGCATTTCGAAAACCAAAATTACTATTTTCACATTACTAAAATATcctgtttttttaaattttgagctCTGTACTAATTAATGTAAGTAGGT
AATTCGAGCCAAGAACATGCTAGGATGGCACGTTTATTTAATGTGCAATGACGTGTAAAGTACTGACTTCGGTAGAATAAACGTGTATAGGTTAAAACCT
ATACGATTTTTGTGAGCTTTGCTAATGTGGTACTGTTGTTAAGTTCACTGCAGAATATCGCCCCCTGGGGAATCCTTCAAAGGCTTGCTACACAGCATCA
CCATATCACATAACTTAAATTGCACAGACCAAGCATGTCTGTCGCCTCATCGATATTGAAGTCTCATGACTTGGACTTTATTACCACATCAGCCTTTAGA
TTTTTTAATCTCTAGATTCTATAGATGCTATATCCATCTCTATTAGTAATGGACTTTCTCAATTGGCCacgaatgccaaattcgaaACCTTTTTTGATCA
TATGGTCTCTTCTGTATTTGTTGTCGTGTTCTCAAACTGCTTAAACATAAAATATGATATGCGATATAGTAGCCCCATTTCCAGCAGCTCCAGAATTATA
AGATACCACAAACCCCTCACGCAGTCAAACACGCCGCTTAAATGGCTAAATGTTTCCTTAATCTAATGGACCAACCACTTTCGGCATGATAATGCAGCTC
AGATCGCTCTAATTTGGGACCTATGGTTTGATAAATGTCGTCGTAATGGTCGCCTGATAGTTCAAACATTCAAGTATTAATGGTGACAGATACAGCAGGT
TCGTGTACGCAATTGCAAGATAAGTTTTCCTTCAATAAAATGAAATGGCCATTGTTTTTATACATGTCATCCACCACAAATCAATCATGATTATGGTAAA
GACGGTCGTCCTTCGCACATAATTCTTGACCAAATGAGAGCTCTCATATAGTAAAAGAGTACCAGCTTTTCCTCGTGCGTAGACTTTACCTGTCGAGTCA
TTGTAAGTTACAAATCCTGTAGAAGTGAAATCCACCTGATGACTTGATACAAAGTGGATCTTTAGGCCTCAAGAGCATTTTCTTAGCCACGTCGAGTCTC
CCGAATCGTTCATTTCAATACGTGGTTGATCTTTGACGTTCGTAGCGTTAAAAGTAAAAAGCTTTCTCGTTTGCTTATTAGTGGTATGTGAGAAGTGAAC
AAAAGCATGTGTGGTGGCGAAGGCAGATCATAAAAGAGGTGAGCTGCAGGTTTTGTTTGATTGCGAACGGAACCCACTAAAGATATTAGTAACATGTCGT
TCATGATAATCAAGTCCACCCTAGACGTAGATCTCTTGTACAATTCTGAAATATACGTTGTCGCTCGCGTCAGTGTACAGGCAGGTTTTTCGTGGCAGTA
GTTTCATCGCACGCACGTCACGGTGTGATACTACGTGCCACCAATAAACCTTTACTCAAACGTGATAAAAGGTCGCAGCTTAACTTAAGAAGTTGGACAC
AATGGAAAACGTATGTGTACAATTCTATTTCATTTAAGAATTTATCCGCTTGCATCCATGGTGTCTCCTCGAGGATATGCTATCCTCGAAAATCGAGAAA
GTGTGACTAAGcctcaaagttttgattttgagatGAAAATCAAATACGAAGGCATCAGGAATCCGTGCGTTTTAAGCTGGACTGATCTGAGCTATATGGT
CAAAATCAAGCAATCTCCAGAATTGCCACGTGGTACCAAGACCATTCTAGACCGTGTCAGCGGTCGATGCGCACCAGGAGAAATCACGGCCATCATGGGT
CCATCTGGTTCCGGTAAGACGACGCTTGTTGACATGCTGGCCGACCGTATCAGTTCTGCTGACGTGTCTGGCGTGATTGAAGTCAACGGTGCGAAACGAG
ACTCCAAGACATTTCGAGTTGTCACTAGCTACGTGGCTCAAGATGACACCTTGCTGGGCTCTTTTACAGTGATTGAGACCATGCGAATGGCCGCCAGGCT
AAGTGTACCGAGTTCCGTCACCTCGCACGAAATTGAAATTCGTGTGGAAAATATTATGGACGCTATGGGTTTAAGCACAGCTCGTGATACGCTTGTCGGA
GATATTTTTCGTAAAGGATTATCTGGTGGTCAGAAGCGTCGTTTGAGTATCGCTATTGAATTGCTGTCAGATCCAAGTATTCTCATTTTAGATGAGCCAA
CAAGTGGACTTGATTCAAGTGCAGCTCACAATGTAATGAAATTTGTGTTAAAGCTCTGTGCCGAGGGTAAGACGGTGGTTTGCACGGTTCACCAACCATC
GTCATTAGTATACGAAATGTTTACTAATGTCATTATTCTGTCGGCTGGACAGACCGTATATTGTGGACCTCGGGCAACAATTATCCCACACTTTGCCTCA
CATGGATACGACTGTCCACACTACATGAATCCAGCTGAGTATTTTATTAGTCTCGTCAACACTGATTTCGACGACCACGCTGAAGTGTCCAAGCTCATTT
ATTTGTACACA