Description :
From Genome Similarity Track
Location :
Scaffold_202:8030- 31988
Transcript NameFunction/comments
Physo_144582hypothetical protein

Sequence
23958 bases(100 bases per row)
TTAACCGCGGATACTCATCGGGCTCCGACGCACCGTCCAGGTCCGGCGTCTACTCCGCCGCCAGCTTCAGCGGGTGTCCGCCGACCGCGGTACAGCGGAG
CCGAGGAATCAACGCGTCACGGGTGCAGGCCTCCCAGTTCGGTCTCGACTCCATCGTCTTCGCCTTCGTCTCGGCTGCTGCTGTCGATCGAACGCGCCAG
GTCACAGCGCAGTTCCAGTCCGAGGCCTCGGACAGCGACGCCCAAGCGCGCCGACCTCAGACCAAGTGGCGACGTCCCTCGTCGCGTTCACTAACATGGA
CCCCATTGAGGGGCCCTAGTACCACACGTTGTCGTTGCTCGTAGTCGCTGTAGCCGTAACTCCAACACGTAGGCCTTGCTCTTTTCCTTCGTTTCTTTTC
ACTTCTTCACATCTTTTATGAGACGGCCCTCCGCCATCTCATCTTCAGCAACAGGCTGGTCCTCCACACTTTCCTCATCCAACACCTCGCTCCGGCCATT
CCCAGAGTCGAGGCTCTCCGCCTATCCACCTGTCGGCAGCCACCCTGCCAACTTCCACCGCGCCACTACAGGCGCTCACCCACCACGTCCTCGCGCGAAA
TCGCCGCAAGACGGTAACGACCAGCGTGCTGTCGCGAGAAGTCGCACCGCCACTTTCCGCAGTTGAGATCCAGTTCGTCGGTACAGCCTCTCCAGGTCAC
GCCGGACTCGCGGCGCGCGCAGCCAGGTCGGGAAGCCCGACCGGCATGCAGCTCCAAGGACTTCTCCCCTTCGGAAGCACCCTCGTCCAGAGCGAGTGTC
AGGCTGTGCTCCAGTAAACACGTATCGGTGGAGTCAAACGGTCCGTTCGTTGACACCGCCAAACACGTCGCGGCGTGTGACGGAAACTCTTCAACGGGGT
TTTGCTTGGAGGTGCGGAAGTCGAAAGATAGTTGGTAAAGCGAGTTACTCGTCTCGCGACGCGATTCGTTTGGCCTGCCTTGCGCTTTGGTGCACAACCT
GACGCGCCGCATCTGCGCACGCGGTCCGATCTGTAGCTTCTTTCGCTTGGGTCAGCGCACTGGTGCGGTAGTTTTCCGACGGCGATTATCGCCCTTGACG
TACACCGCGGATCTCGGTCGCGCACGAACCGAAAGGAGAGCGCCAAGTCTACCACGACGCGAACCGTCTCGGCGTGCTTGTCCCTGACCTTCGAGTACGC
AACGCCGTCGCTCATTACAGTGCTAGTGTCCCGGCTCACTTCTAGCGGCATCTCGTCGCGGCAGTCGGCGGGCTCGTTCGACGGGGTCGTCCCATTGATC
ATAGCGCGCACAGGCCTCAACTTGGAAACGTCCTTGACCGAAAATTGACAAGGCGTGCAGCCCGTCTCAAGACGTACAGCGTACGTGCTCACACATGGGG
CGTCTCGCGGCACAGCGTCGAGCATGAGCTCTAGCCCGTAGGCAGATCCCATTCTGCCGCGATCCCAGCAATATGACATCAACGAATTCACTCCAGCCCT
GTTCATCGCCGCGACGTCGCCCCGGGTCCGATCTGCGTCGTCCCCGGCTTGGCTGACTACTAGCACGTTCACCTGCGCGAGTCGGCAGTTCTGAAGAATG
CATATCCCTCGGCGCGTCGACTCTGTTCCGTCGCGCGACGAGTCACTTGCGGCGTCCGACACGCTCCTCGCAACCTCGAATTCCCAATCAGCCTCGACGC
AAGGTGGGTTTCTGTTTATCGCGTCGTCGCACTCTGAGGGCTGTGCTGACGTTGGACCCTCCACATATTTCGACACTGCAACAAGCCTCCTGATCGGGCT
CGACGCGTTCCTCGTTGCAGCAGGCTCGTTGCCGGCCGCCTGCGTCCTAGCCGCGTCGAGGCCACTGTCCATCGCCCCGCGTCTCGCCTCCGCGTGACTG
TCCATCGCGCAATGTAGAACTTCTGGCATCCTCGTCGCGCTCAGGCTCCACGCGGTCCGCGCTGCAGCAGATTGGATGCCAACTGCCTGCGCTCTCGCCG
CGTTGGGGCCACTTCCCATCGCCCCGCGTCTCACTTTCGCGTGACTGTCCGTCGCGCGATTTAGAACTTCTGACATCCTCGTCGCGCTCAGTCTCGACGC
CTTCCGCGCTGCAGCAGATTGGATGCCACCCCCCTGTGCTCTCGCCGCGTCGGGGGCACTTCCCATCGCCCCGCGTCTCGCTTCAGCGTGACTGTCCGTC
GCACGACATTGACCGTGTTTCGTGGCATCTGGTTTCCTGACGATCTCCTCTCGGTGGTGTAGCGTCTTTGCGCACCGGGTCTGCGACAAGTTTTCCGTCG
CGTTGCACTCATGACGTTGTAGCTCGCATCCTGCCAGTGCGTCGGACATGCGCTTAAGCTCGTGGGGGAGACCGGGGCTGTCGCAATCTAAGCAATACCG
TATCGGCAAATTGACTTCAGCCGTGTCCGTCGTCGCGACTCCGCCCCGAGTCCGATCTGCGACGTGTACACCTTGGTCGACTTCTAGCGCGTTCACCTGC
GCGAGTCGGCGGTGCTGTCGAACGCATAGCCCTAGGCGCTTTGACTGGGCACCGTCGCGTGACGTGTTTCTCGTTACGACCCACACGCCACCCAAAAACT
TGAATGCACAACCAGATCCGACGCAAGACGCGTCTTCGTCCAGCGCACCGCGCCCCGTAAAATGCCCGGGGCCATGACTCTCTGCGCCTTTAGCCGCCCT
GGGAGGGGTCTTGACCAGGCTCGACGAGTTCTGAGCAGCCAGCTCTTGTAGGACACCTGGAGCTCTGCCTCTGGGGTTCGTCGCGCGTGTAGAAGCCGAG
TGCATCGTCACCACGAGGACGTATGCCGTCCCGCGCCCCAAATCCATGTTCTCCGGCGTCGGCGGGTCTCGTTCCGGCACGTTGACGACAGGGTCGGCCT
CGTCGCAGTTGCCCTCGTCGCAGTTGCCCTCGTCGCGTTCCGCGTCGAGATTTTCCACGTCGAGTTTTTTCGCGTCGCAATCTTCCGCGACGAGGTTGAC
AGGTGACGCTGTTTCTGGATCTAACGTCCGGGGTCGGATGTCTTCTCGCGAGTGATCCGCCGGCTGTATGACAAACACCCCTGCCCCTGCTGCGCTGGCG
TCACCGTCGCTCGTCCCGCGTCTCGTGTCAGCGCGACTGTCCGTCGTGCAACGTGGGTCTGGCACCCTCGTCGCGCTCGGGCTCGACGCGTTCTGCGCTG
TAGTAGGCTGGATGACCCCCACCTGAGTCTTCGCCGAGTCGGCACCGTCCTTCGCCCTGTGCATCGCGCCAGTGCAACCGGCCGCCGCGGAGCGTTGACC
GCGTTCCCCAGGATCCGATTCCCCGGTGACCTCTCGGCGGTGCATCGTCTCCGTGCACCGGATCTGCGACGAGTTATTCGTCGCGCTGTCTTCTTGATCT
CGTCGCACGCATCCAACAAGTGCGTCGGGCCCCGTGTTCCCGCCTCGACGTACGCCGTAACGCGGTTGTACGTGTAGTGTGTCACAGGTTCGAAGTCGGT
GTAGCTGCAGGCTGCGTGGCTCGTCGCCCGCCTTGCCCGCCATCTTCAGGACCGCAGACTTATTGAGTTCACTGGACATCCGTCGAGTGACAGCTGGTAC
CTTCGCCAGCAATCCTCCAGGTGGCGCACCGTGGCATTCGGGCTTGTCCACAGGAAATCGCACCACTCGCCCCGCCGCGGCGTACCCGCCACTTCGATAG
ATCGCGCAATTCGGACCAGCATCTTGCTCAGGGTTGACCAATCGATCTAGGTTTATGGCGCGGTGCCTCTCTTTTGGTGCAGACCCCGGTGGTCCTCCAG
TCCCGCCACCGTCAGGCCCCTCGTCGACCACGTCGAAGTTCACATTCGGCTTGTTCTTCACGGGCTCGAGGGCGGAATGTCGCCAAAGACGCCATTTTCC
AGCTTTGTCCCCAAGTCGCATACCGTCGCAGGTCTGAGACCTCGCTACTGACCGTCGCATAGTGTCACATTCGGTCAGTCTCACGTCGTCGCGTCCCCTC
GACCCTTCGCTCGACTGTCGCACGGTGTCACATTCCGTCCGTCTCATGGGCGACCCTTCGCCCAACTGGCGCACGGTGTCACATTCGGTCCGTCTCACGG
TGTCGCACTTCTGGGACTGCTTCTGGGACTGCTTCTGGGACTGCTTCTGGGACGGTTCCGAGACGTTCCATTCCTCACATCTCACACTGTCGCACTTGTC
CCTGTTGGATTTTGCAACTTGCGCGCGTTCGCTCGACTGTCGCACCCTGTCGCATTGCTGCGACCTTCCGCTGGACGGCGCGCCTCGCGCTTCGTCGCCC
GACGCACCTTCGACGGGTTGTTCGACTCGCGACGCTTCAGCTGGGCGCCCCGCATTGTCGCTTCTCTGCGACCCGTGGTCCGACCGTACACACGTCGTTA
CTACGTCGACCCGTGTCTTCAACACCACGCGCGACAGCGTCGAGTGGCCACGCGTCTGCAACTTGCTCACCGTCGACGTCTCCACCGCTGGCGCACGGGT
CAGCCCCGCTGTTGGTGACTTCACAGCGACTACTGGGTACGATGTGGGCTTGCTATCCGCGTGAACTTCTTCCTCTAGCTCACCTCGACGCGCGTCGAAT
TCCAGATCTTCGTACGTCGGCCATCCATACATGGGCCAGACGAGCTCGTCGTCACGCCAGGTCTCGTCCTCGTCGCAGGTCACTTCATACGCAAGGTTTT
GCCAATCTTGGTACTGTCGATTAGTCGCCAGCACGAAGCGGGGCGCAGGCGGAAACACATCGGAGGGTGTCCACCAACCCACGTTCGTGCCTGCGTCGAG
CGTTATTGTCTCGTCCGTGACGTTGGTCACCCGCAGGTATGTTTGTCGCTCGATCTTAGTCTTAAACATGGTTGTAACCCACGTTTTGCTGCGCGTGACC
CACAGGCGCGGTGCATCTCGGCTGGAGCGCAGGCGGACGTCGAGTGTTTGCCCTGGGTCGAGTCGCTTAAGCGCGTCGAGTGAGACCGGCCGCACTCGTG
CGTCGTAACGCGATTGCTCGGGAGTCGTAGAGGCCCGCGCCGTGCCCAACGGTCGCCTGGATGTCGTCGCAACCGGCACTGCGACGGACATCACGGCGTG
ATTACCAAGTCCTTGCTGGCGCATCTCCTTCGACGCGTCCCGCGTCGACATTTTCTGCGTCGAGTTTTTTCGCGTCGAGTTTCTTGGCTCGACATGAACC
GCAGAGACATGGGTATTCGACGCCTGAGTTATCGTAGAGCGCGTACTCGCCTCTTCCAGCGCCTTAGGAATTGCTTCCTTCAGATCCGGCAGAACCTTGA
TACGCGCTGGCGTGACCTCACGGGGCGTAGCGCGCGGCGGCTCGCTCAGGTGGTCGAAAACCTCGTCCAGTTCCGGTGAAGTCGTGGTTGAGGTCGCGGC
CGTGGTTTTCGGCATCCCGAAGTCCACGTCAAACAAGTCGGCGGGTTCGTCATCTACGTCGCGTCGGGGTTTGGACCTCGACGTGGAATGCACGATCGAC
TCAGCCTGGGACGAAGTTATCATCTGCGTTGAGATTGGGCGCATCCCAGGCGGAGTCACCTTGCGTTGGATGGATCCGACCAGGACCGTCAACGGTCCCA
AGACGCTGCGGATCGTAACGTGTCCACGACTCGACGTCCCAGTCATACACTCCCGTCCTCTCGGTGATGCCCAAGCTGAAGCCTGATTCGTGCAACATCT
CGAAGAGTGTCCCTGCGGCTCGCGTGACATTCGTGAGCATGTCAAAGTCCGGCACCCGGAAAGGACCCGTGAACTTGATCGCGTTGGGCTTGATGAAACG
CAGGATCGGATCGTGCTCCAGCAGCCGGATCAGCTCCACTCCAGCAAGCATATACCTCATCTCTGCCGCGGTGAACTGATTCCCCATGTCATCGCCTCTC
GCCTTGACCGGCGGTCCATCCGCTAAACCCGGCGCGCAGAGCTTCTCCGGAGACTTGCGCTTGCGCGACTCGAAGCTGCTATTGAAGTCCACACTCGATT
GGTATCGAGGTGGCGGCGAGGGCGTGGTCGTCGAGGTCTGGGCTGAGCCCGTCGAGGAACTCGGCGCGTCTTGGCCCGCTGAGAAACTCGTCGCGTCTTG
TTTGACGGATCCGGCGAGAATCGTCAAGGGCTCCTGCACGACGCGAATCGCGCGCATCTTGAGGTCCCAGTCGCACAGCTCCTCCATCTCGAAAGATCCC
AGCACGAACCCCGAGTCACGCAGCATCTGGAAGAGAGTCGGCGCGGCGTGGGCAACGCTGGTGAGACTATCGAAGTCCGGCGCGACGAAGGGGCCCGTGA
AATTGCTCATCAGCATGGGCTTGAGGAAGACCAAGATCGGGTCTTGCTCCAGCAGCCAGACGAGCTCAGAGCGCGCCACGACGTACCGCACCTCTTCGAC
GGTGTACTGGCGCCCCGCGTCCTTGCCTTGCGGCTTGGACAGCGACGCTTCCGCCGAGTCCGGCACGCGCAGCTTCTTCTTCTTCCTCCTCTTGGGTGAC
TTGCGCTTGGCGGCGGCCTTGGCGGTGGGTTGCTGTTGGTCGTCGGCCTTTGCAGGCTTCCGACCAGTAGGACCGCGACTTGCGTCGCGGCCCTTCGCGG
CTCCCTCGTCGGGAGCCGCATCGGGAACGGCAAACTGTTCTTCGTAGCCCTCCTGGTCGTCGCTGGCCCCGTGTCCTGTCGTGAAGGTTCCCACAGAGCT
CCACGACGCGACAGGTCTCTCACTGTGCTCTCTTGCGGTCGGCGACCTTCCAGCCGACTGCGCACCTGCCTCCAATGCCTCTTGGATCGTTGGCCCGTCA
TTCGAAGTAGTACTCCCGGGTCGCGGCACCACTGTGGAGTAGCGCCCTCGCAGAAATCTCGCGAATGCGATCTCGCACAAACTCGGCGCGTCTGGATAGC
GGTCGCGCCGAGCAAATTATTACCGGTTGTTGGAGTAGCGTATCTTCGAAATACAGGCCCAAGTCTTCGCAGGCTTCGGAGTTGGGGGTTCTTGTGTTGA
CGCTTGTTCCTTGTCGTAGGGCGTCGAGCCTTGGGCGTGCGGCGTTATCGGGCCGGCGTTTCCTCGGCGTTCCCGTCGGGCGTGCGGCGTTATCGGGCCG
GCGTTTCCTGAGGCTTGTGTGGCTTATCGGACCTACAGGGGGTCTTGTGCACGGCGGTTATCAGGCCAGTGCGGTCCTTCGCCTAGGCAGCGCGTTATCG
GGCGCCCACCTAAACGGTATACGTTTAACGTGCCTTTGTTCCAGCACGGGTCTGTGGGGGGTGAGCACCCGAACCAGCAAACGACGGGGGGCCGCGATAT
CGAGGCGGCTCTACTTGCCGGCGCTTGGTGGTTCCCCTGGAACCTCGGAGAAGACGGGAGGTCTTTGTGGTTCAGAGAAATTTCGGGACTGATATCCTAT
GTCCTTGCTACTGGCTACTCCGTACTACTGCTTGCTAAGCCTACCGCTCTGTGCCTATCCCTACTTCTGTCGTGCTTGCACTGCCGTCCTTCAACCTGAT
TTGCGTGGCGTAATCAAGATCTTACCTCGGCGCGTTTTGGTCGGCCGGGGTTTTGCTCGGCGCGTCTTACTCGGCGCATCTTGCTCGGCGCGTTTTGCTC
GGCGGGGTTTAGGGTCGACGCGTTTTGCAGAACCGGGTGCGCTGGTCGGCTCGTCGGATGATTACGCGTCGAGTTGGACTCTGTCGCTGTGTCTCGCGGC
CCATCACCCACGCCGACTTTCCCGTCGAGCTCGGCCCTGCGTCGCTCCCATCAATCCACGTCGCGTTCCATCAGCCGCGTCGAAGTCCATCACTCGCGTC
CCGGCGCTTTCTTCCTCCGGCGCCCGGCGCGCCCACTTCTTCCGCGGGGTACTACACCACACCTGTTACGCGGGTGACCCGGGTTCAATTCCCGGAAGCT
TCTTTTGCTGCCACCTGCTCCACTCGCTCTGCTTGCTCCTTTGCGCCCGTTGCATACTTCGCGCAGCTGCCCACCCTGCCTGGCCGCTGCTTTGGTCCTG
GGCGCGCTTGTCGCGGTCAGTACAACCAGTGGGAATCGACCGGGGACCCTAGGAGCATCGTCGGCGATGGTTTCTGCGGGAGTGTTCGGACGCGGTGTGG
CGCTCGCTGGGCGATAGCAGGGTCTGTGTGGAGCGTGCCTGGGTGTTGGCAATCGCCATACGAGCTGGATAGACGCTGTACCGAAGGCGATGAGTGGTCG
TGCGCCGCAGACTGTAGTGCGTTCCGTGTGGTGTAGTGCCCAGCGAGGAAGCGGGCACGTCGGCGTCGGTGAAAGAAGGCGCTGAGACGAATGCTGATGG
ATGCGGATGATGAACTCGACGCAGTTCATGAAACGCGACGCGATTGATGGGGGCGACACGCGGCAGAGGTCGACGGAAAGTCGACGCGGGTGATGGGCCG
CGAGACACAGCGACAGAGTCCAACTCGACGCGTAATCATCCGACGAGCCGACCAGCGCACCCGGTTCTGCAAAACGCGTCGACCCTAAACCCCGCCGAGC
AAAACGCGCCGAGCAAGATGCGCCGAGTAAGACGCGCCGAGCAAAACCCCGGCCGACCAAAACGCGCCGAGGTAAGATCTTGATTACGCCACGCAAATCA
GGTTGAAGGACGGCAGTGCAAGCACGACAGAAGTAGGGATAGGCACAGAGCGGTAGGCTTAGCAAGCAGTAGTACGGAGTAGCCAGTAGCAAGGACATAG
GATATCAGTCCCGAAATTTCTCTGAACCACAAAGACCTCCCGTCTTCTCCGAGGTTCCAGGGGAACCACCAAGCGCCGGCAAGTAGAGCCGCCTCGATAT
CGCGGCCCCCCGTCGTTTGCTGGTTCGGGTGCTCACCCCTCACAGACCCGTGCTGGAACAAAGGCACGTTAAACGTATACCGTTTAGGTGGGCGCCCGAT
AACGCGCTGCCTAGGCGAAGGACCGCACTGGCCTGATAACCGCCGTGCACAAGACCCCCTGTAGGTCCGATAAGCCACACAAGCCTCAGGAAACGCCGGC
CCGATAACGCCGCACGCCCGACGGGAACGCCGAGGAAACGCCGGCCCGATAACGCCGCACGCCCAAGGCTCGACGCCCTACGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN