Description :
From Genome Similarity Track
Location :
Scaffold_27:8030- 9426
Sequence
1396 bases(100 bases per row)
TTGCCGAGTAATAACGTTTGAGTCTATCAATATAGAAAGTAGGGTGTACGCGTAGGTACTTTGGGATGTTGATAGTGTAAGCGGACCCTCTTTTAAACAA
TATCTTGAAAGGACCAATAAACCTCGGTAATAACTTGTTTGTCCCTAGGCTCGATATCGATTTCAACGGCAAACCAACCGTTCATAATAGAACACGATCA
CCAACTTCGAACGCATTGAAGTTTCTACGACCACTTCGATCGCCGTTTTTCTTCTGCCCATCGACTGCATCCGCGACGTTATCGCGAATAAATCTCAACA
TACTTTGTCGTCGCAAGATGGATTCGTTTGTTGTTTGTCGCAGATCGTGGGACGTACCTTGTGCGTCAATTGTGAATCCCGAATGTTAAGTTTCTTATTC
TCGCTAGTATAATCTTGTATCTCATCGAATGAATCAGCATTTTGCGCTGTAAGGTCACGTTGGGTTGTACTCGCTGAAAGCGCAGCGAGTCTGTAATCAG
TCGCGGTGCTCTCTCCACCAACAAGCGTAGGGCAACCGACCAATGTAGAAAGGGTAACTGGGACGCGCGGGTCCTGCGCGTAATCAGCAAAGAATCGGGT
GACGCCAGTTAAGATGTGAACGGAATTGTTGAGAGGGAATTCTATCAGTGGTAAAGATGTTGAACACTCGGAGTATGATTAAGCGCAGCTGCGAAGGGTG
TCTTCCATGACTCTTTTGGCTCGTTCCGTCTGGACATCCGTCTCTGGTTGGGCAGTTGTTTGATATTGTCAACGTTGTTCCCAACGTCGAAAATACTGAA
GTCCAAAAATTGAGAAGTAAAACGTGAGTCGCGATCACTTACAATCGTGGTTGGGAGTCCGTGATGTCGGAAGACGATTTTGATAAACAATATTGCAGAC
TCGTCTGCAGAGATTGAGACTTTTACCGGGACCAAATGAACCATTTTGCTCAGGCGATCAACGAAGCCGAGAATACCCAAGCTACCGAACTTGTCGATTG
GTAATCCGAAAACAAAATCCGTGGATTCCCAAAAGTATGTGGGAATAGGTAATGATTGTAATGGAGCCCGTACAATTGCTGACGGTTGGACACGCTGGTA
GATTTCACATGTTCGTATTCACTCACGCATCCATTTGTACATGTGGGGCCAAAAATAGTATCGTTAAGGCATGATAAGTCTTGTCTCTCTCTAGATGACC
AGCTGTGGCCACATCGTGGAATGTATGTATCAACGGATGACAAAGTTCATCATCAGTTGGAATAGCTAAACGAGGGTCGTCGGCAGGGTCAATTTCGGTA
GTACAGCAAGTTATTCATGAGCTGATATCGGTGGTCGCGTGCACGGATGTGTGCCGGCAAGTTTTGCAGCGCAGAGGGTGAAGGTGATTTCAGATA