Description :
From Genome Similarity Track
Location :
Scaffold_1813:803- 6762
Transcript NameFunction/comments
Phyta_totarag13699reverse transcriptase
Phyta_totarag13700hypothetical protein PHYSODRAFT_257054

Sequence
5959 bases(100 bases per row)
CGCTGATATGTCCGGCCGATTCCTTGATGGCCACCTTCCAGGCTCGCGTGGTAGTGATACAGGACGTCCTCGTGGAGCGTCTCTGGGaccaccagcttca
tgaTCGTGTCGCGCTCTTCAGCCGGTTCGTCTCCTCTCACGTGGTAATACAGTAGttcgccttcaccttcttcataTTGGTGGgcgatcttgctgcagtt
cttcgcCTCCTGCCTGGAGAGTTCTCCGATATCGCCGTTCAAATACTTCTTGAGGTTCACGATCCAcagctcttcgtcttggACGATCCGGATGCGATCT
AGCCTGAGTCACTATACGACCAGCTCCTGAAGGACTTCCGGTGTCCTAGCCGGGGTTGACGGGGCCCGTGTTGCAGCAGACCGGGCGGTTACTGCTTGCA
CTTGTGCCGCCCCGAGTTTCGTGTCGGCGCGATCTACCGTCGACTGGCGTAAATCGGGCGTCACTGGATCGGGTCTTCTAGGTCAGACGATCTCTCCGAG
ACGATCCAACGTCTTCAGATCTTGGATTTCCTCCAGGCTGCGGACCTCTATGCCGCCTTGACGTTGCAACGCCTGTCCAGCCAGCATATCGGCACTCGCG
TTCCAATCTCGACGTACGTAGAAGAAGTCGTGACGGGGCCATTCTTGTAGCGCGTTCCGGACTCGCTGCCGGAGAAGTTTCAGGCCTGGTGACTTGCAGT
CCATCTCTTCTCGCATTTGCTGAGTGGCGAGGTTTGAGTCTCCGCAGATGATCAGCCTTGAGACGTTCAACCCTTCGAGGAGCGAACATCCGAGCAGCAT
ACCTTGGTATTTCGCCTCGTTGACCGTAAGATATACCGCGTATCTTGACGCAGCACGGACGACTTCCCAGCCTGGTAGCTTCCAGATGATCGCGCTAAAC
GCTCCACATACTCGCTTGGCTTTGGCAGATCCGTCGAAGCTCATCACgtggagctcttcctccgGTGTGATCGCCGGGATTGGGATGACGGCAATTCGCG
ACGGACGCTTGCCCGGTGCGATCTCTTCCAGGACGGTATCCACGAAGGGTCTGGGTGTGATGCTCGCGGCTAACTCCCCAAGtatctcttcttctccttt
cgtGGACCGGTGAATCTCCAGCGTCCGTGGTGAGAGTATGGCGGTCCATTGCGACAGTCGACCTTGTAGTCTTTGGATCGGAACAACCACACCAATGTTG
TGTGACGGGTCAAGCCGCGTATCGAGTTCCCAGCCAGCATCGTGAATCAGTTGTTGAGGATGCgcagcaaggccaagatctccttctcgacgatgTCATA
GTTCAACTCGTTGGGCTTCAATGTGCGACTGGTAATTTTAACCGGCATGTACACGCCGTCGTGAGCTTGGGTGAGGACTGCCGAGATTGCCCAGTCGCTG
GCGTACACGATTACGACGGGCTCTCGGGATAAGTTGTAGTGCTTCAATATCGGGGCCTCGGCGATCTTGTTCTTGAGGGCCCCGAATGCACTGGACGCAT
GTCTCCACTTCTCCTGTTCGCGGACTTCCGGTTTCGCGACgtagtcgtcgaagtcgGTCTCCGTGAGCGAGTACAATATGGTCGCGTAGATCGCGAAGTC
GGCGGTGAACCGGTGGTAGTAGTTGAGACTGCCCAAGAAGGATTGCAGGCCTTTGAGTGTACGCGGTAATTCTAAACTCGTGAGCGACTCCAGATTCTTC
GGCTTCGCTTCCAACCCGTGCTCCGACACCTTGTGACCCAGGTAGTTAACCTGAGACATTTCTCACGTTCTCTTCTCCACACTGATGGACAAGTGCCATT
GTTCGCAGACGTCCAGCAGGCGTTCCGCCTTCTCGCACAAGTCGTCCCATGACGTGCCACCGATCAAGATATCGTCGATGTACGATCGACGGCCTAGAAC
GGAGTGGATCACCGGAAGTTCCGGCTTTCCTCCGTCGAAGACGTCTCGTGTATCCCGATCTGGGGTCAAGCTCCAGAAACCATAGAGCGCGTTGTCGATC
AGTCGCTGGTATATCTGTGGCGCGTTACACAGTCCGAACAGCATCCGTAGCCATTCGAACAGCCCGAACGGGGTGATGAACGCCGAGATTAGTCGGGCCT
GATCTGTCATGGGGACTACCCATAACCCACTGGCCATGTCGAGGGAGCAGTACCACAGGTATTTATCCAAATCTCCCAGCAAATCGTTGACGAGCGGCAT
CGGATATACCATCAGCTGCGTCAGCCCATTTACCAGTCTGTAGTCGATGCAGAGCCGAATATCGACcccgttcttcttcacaatCACTACGATGGATGAT
GCCCACGGAGAAGTCGACAGACGGATCATGCCCGCGCTGAGCAGCCCCTTGAGCAGGTCAGAGACCTTCTCTTTGAACTGAGGTGGGAGCTTACGGACGC
GTTACGCTATGGGCTTAgcgtcgccgacgtcgaTATCGCAGACGACCCCTATGGCAGCGGGCGGGTTTGCGGTGCCTTTCCCGATCAGCCATTTTCGCCG
CTTCCAGATGATCCGGCGCAGCCGGTCTTCTTCCTTCGTAGCTACCTCCGGTATGACCCCGGCTGGTCTTCCGACTTTGAGATCTTCGATCTTCACTTCC
ACAATCAGAGAGAGTTCTGTCAGAACGGCCATTTCTCCCTCCAGTTCTTCTGCGAAGAGGTCCGACCCTTCGTGGAAGAGTACAGCGTCGTCAGCTTCTA
CAATCTCGTTTGGCCCATCCGACGCGGTATCCACTGGCACCTGATTCAGAGGATGCATTTCTTCCACTTTCTCCCGTTGTTCCACGATGTCGCACTTCTG
CGGCTCTCGCGCTGACTCTTCGCATTCAGACGTACGCGTCGGTTCTGCCGCCGTAATCGCAGCAACCGTTGGGGGCGACTTCCGCTGGCGTTCCACTGGG
TCTTCCATCTTCCTTTCACCTCGACGCATGATTCCTCTGGGGGTTTCGTGTGTCGGGCGCTCAATCATCGGTCCGTCGGGTTTGGCAGGCGTCCAGTCTT
CGCCCGCGTCGCAGGTGGAACCGTACGCGAGGTTCTGCCACTCTTAATAGCGTCGCGACTCAACTTGtacgaagccgaagccgcgTGGAATGGCACCGAC
GGGCGTCCACCAGCCCAGCGTCATGTGGGCGTCGAGTGTTATTGGCTTGTCACCGATATTGGTCACCCGCAGGTACGTTCGTCGCCCGATCTAGCTCTTC
ACGAAGGTGCTCACCCATGTTTTTCCTCGTGTAACCCATAGTCGCGGAGCGTTCCGGTCTGGTCGCAGGTGAACGTCGTGCGTTCGCCCCgggtcgatct
tctcgagcgACGTCAGGGTGATTGGGCGCATCTTCGCACCGTACAGCGGTCTTCTTCCGATCATCTGAATCCGCACCTCGTCGGGCAGGCACGCCGTGCC
GTCCGCGGTGTCGATGCGCACTCCGGCTGGCACCATGAAGTTCATGCCCAAGATCGCGTGTTGGCCCACTAGGTCTCCGACCCAAATGTCTAGGAAGTAG
ACCAAGTTCCCCGCTAAGGTAATTTTGATCCGTGTCTTCCCAACCGTGTAGTATGTTTCGTCGCGGATTCCCACACAATTCTGCGTTATTTCCGTATCGA
CCAGACAGCCTACCTCACGAGGAAAGGTGGTGTCCAGTATGGACACCTCGGCACCTGtatcgagcagcaacgtaGCACGACGGTTGTTCAACTTCCCGTA
GATCTTGGCCTGCCGATACCACTTGTCCGGCGCGTAGTAATTTCAGTATCCGCGTCGTTCTCCAGGCGGCAGGTCGATCACGTCCAGCGGCGGCTCTAGC
GCGTACTCGTCCGGGAGTCGAAGGTCCACGACTCGGGGAACGTGTTCTTGCGAGGCACGCTTCAGGTTGGATTCACATGTATTATCGATCGAGGTATCCG
AGTCTTCACTAACCACCTCCTGTGACTTCTTGGTCACATATGCATAGACGGAAACAGGTGGCTCGTCTCGATCTGGTTTCCAAGCCAGCCAGTGATCACG
TTTGACATATTTCGGCCACCAGTGGCAGCATTCCAGCATGCTTCTGCCGGTCATACCACTGGCAAAGCTGGATGAAGAATTCCTCCATGGGACATTTATC
GGCTTCGTGCACGTCTCCACGCGTGTAGGCATCGGTCCGTCGGGTGATGGCCACCGCACTTCTGACAGGTCAATAAGCTCCAGCAGTCTCCGTCTGAGTG
ACGGTATGACTTGCACTGGCGGCACCGCGGCTTGTCCCGCCCCAAGTCATCCGCGTCAACGCTACGACGTGCGTTCTTGTCCGGCGGCACTTGGCCCGTC
ACAAACAGCTTGGCCCGTTCGTcgcctcgatcttgatcGTACATCTGATCGTCGGTGCCGCGGTCGTCGCGCCCGAGTCGTATCCATCCGACGCGACTTG
GACCGCGTGAACCGCGCGTGTCGACGCCTTCTGGCGGAACTTTCTAGATCCAAACAaggtcttcttctggtgaGCGAGTCCTCGCTGCCGAGCGCGTAGC
TTTTTCTCCAGCGTAACGATATCCGACACTTCCATCAAGGTAAGTCGAGAGGCcagttcttgttcttgtgaACCGAGGGTGTTGATGAATAACTCCACGT
GCTCTCGTTTCTCCTCCTTTGTGCTATCAGATAGTGGATCTTGGCCCGCATTCCCGCGACTTTAAGTCAATACAGATATTCCAACGGAGTCTCATCGGGA
TGTTTGGTGGCATGGTAATACCGACTCGCCATAGACACGCCTTTGCCGCAGTACTGGATGCGGAACTGCTCCGTCAGATCCGTTCACGGCTTCTTGACAT
CTCAGCCCAGCTGCAGGTACCATTGGTGCGCGGGTCCGGTCATCAAGTCACAGAACAGGGCGCACACTTCGTCACCGGTCATGCCGTCGCGGCGCGACGC
TGACTTCACACGGTTGAGCCAGGTCCGGGCCTTCTCTTCGCTGGAGTCCCGACCATGGAACTCCTTCAATTCGGAGAACGCGGAGAGGCGTACGCGGGTG
ACAGCGACTCCAGTGGTGccggccgtcgtggccgagATAGTGGCAGCGTTCCCAGACGTACCGGTTTCCAGGTCGAACAGATCGTTCGGGTCCTCGTCTC
GGTTGCATCGAAGACGCGGGGATCGGGACGTGGAGTGTGCACTCACCGACTCCatggccacgtcggcgtctGCCGGCTTGGGCGTCATCGTCGGTTCTGG
CTGTGCACGGGGTGCCTCGGTGTTGGCTGCCTGCATCATCATCGACTGCATCAGTCGGACGATggcgtcttccagcgcctGGGGATGGATTCCTCCTTGG
CAGCTGGCGGCTCCACACGGGGTAGCGCTGTCGTGAGCTGCATGACGCGGAGTGGTCTGCCTTTCGGCATAGACATCCGCTTGGGCgactcgacgctgct
gtcaGAGCCCACGCTCGACGGGTACAAAGGAAGCCGTGGTGTCACCGGTGTCGACTCCGTCTTGGCACGAGGTGGAGCGGCCTCGCTTCCGACCGTCCCG
ACCAGAACAGTCAGGGGGTCGCGGATAGCCGTGATCGTACGCTTCCAAGACGCGAGGTCCCAGTCATACACTCTCTCCATCTCGAAAGCTCCCAGCACGA
AACCCGACTCTCGGAACATGCCGAAGAGCGCGTGCACTGCCAGCCGTACGTTGGTGAGGCTGGCGGCGTCAGGAGTCCGGAAGGGCCTGGTGAGCTTGCC
GATCAGCTTCGGCTTGAGAAAGCTCAAGATCGGATCGCGTTCCAACTGCCGAAACAGCTCAGTACGGCTCAGGCCGTaatccagctcttccgcggTGTAC
TGTCGCCCCGCATCTTTGCCTTCTGACTTGCGTGGTGACTGCTCGTCTGCCGAGCCCGGtgcgcgcagcttcttcttaTTCCTCGCTTCCTAGGGTAGGG
TGTTGTCCAGGCTTGGGTTGAACCTTGAAGCGTGCTCGGGCACAGCGCGGattcttcct