Description :
From Genome Similarity Track
Location :
Scaffold_364:803- 2201
Transcript NameFunction/comments
Phymu_g9122hypothetical protein

Sequence
1398 bases(100 bases per row)
CGTAGGTACGCTAGCAGCAAAGGCTCGGCTTGCTGACCAAATTGGAGGACATGGTCTTTGTAGTCTGTCGCCTTCGTGTCAAGCGCAAACCCAGCATcca
agaacagcttcacgaAGGCGACAATGTAGCGAGACTCCAATTTCTTGTGCTGGGCTGCGGAGTCCCAGAAGCGAGGAATACGCGTGTACCATGGTTGGCA
GGCCTGTAACCTGCTTTTTCCTGCGCTTGAGCTTTGGTTCGTGATCTGACATGTCTTGTGTTTGCGCCACTTCAGTCGTTTCTTGTGTAGCTTTAGGTTT
GTGTAGAGCAGACTCGACGATAGTGATACGTGCAGCCATGGTCCTGTTTGAAGCAATAAGCTCTTCAAtgacagcaagaaggtgctcgTTACCGGTACAT
GAGTCTGGCTTCTCTACATTTCGTTCATGTTCTAGAGTAGGCGCCGTTCCTGCTTCGCTCAAGACCACAGACCAAGCGAGTATGTCTGCGGTCGAGATAC
CAGCCGCAGCCATGCACTCCTCCACACGCGTCACGATGGGAGCTTCGGGTGCAAGCGCTTTGACGTGAGGGTAGTAGCGGACCAGGCGAGCTGTGAGTGA
GCTACGGACCTGGCTACTGACGTTGAGCCGTGTGTCGTTTAGGCCGATGCAACTACTGTACAGGTGAGCTTGCAGGCGTTCAAGGCGCTAACGCGTTGTG
TGGTCAAGCCCACCGATATCAACCACTGCTGGAGAATGGTCTGCGCTCCAGCCGCTCAAGTCGCGCACCACCTCCCTGTTTTCACGCGCCGTGTTCGTGA
TGTAGGCGAAGGCCTTGTTGGTCTTCGTCATATCCCAAGCCCCACGGTCGAAAATCCACTGCGCGGCTAAGTTGTCGTCTCCGTTAGCGTGTTGGGCCCC
TCCGTGCCGGAAGGAATGCGACGTCAAGCCGggcgaagcaccagcaggcCCGGTAATTCGTTTGAGCAGCCGATTCACGTGCGTATGGACCCCTTCATCT
CCACGCTTGACATCCTGCGTGCGTGGTGGCTTCAGCAATGGTGTTGTTACTGTTCTGGATAGGGTGCTTGCAGGTGGATGAAGCGCTGTCACCAGGGATG
GAGGTGCCGCTGTTGGGACTACAGCTATTTGAAGCGAAGCGGGGTCAGCTGCAAGGAGGTCGTGTAGCAGGGCTCCTGGATCTAGTGCGTCGACGAACTG
AGGTGCCAGAGCAGGTAGCTGGTCAAGCAGCTGTGGACACGGCGCTTTCTGcatcgccaccgccaccgtAAGAAGGGGGCAGGTCAAGAAGTCCTGCTTG
TCCGGTACGAGGGCGAGGTCCTGCTCTTCTGCCGTCTTTACCCGGAGCAGCCGAATGTAGAACACCGTATCCGCAGCTACTGACACGTGTGGCTTCTG