Description :
From Genome Similarity Track
Location :
scaffold_28:80297- 81812
Transcript NameFunction/comments
Pl_111813hypothetical protein PHYSODRAFT_342126

Sequence
1515 bases(100 bases per row)
CTACTTGTCCTTCAGGTAACTGGATTCGTCAGCTGGCCATAGCGCCCCCCAGTGCGCCTTACGCGATGCACGATACACCTCGCGAACCGACTTACCTCTG
GTAACACTACGACGCTCTAGCTTTCCCTACATCCAAGTAAAACAAACGGCTATCAGAAACTCGGCATAGAGTACACATCAACAAAAAACATTACCTCGGG
AGTACACAGGTCGAGGTGTACATGGCGAGTGGCAAGCAGGGGGCCTCTTAGCATACGAGCAACCGGTTTCTTCTTCTTGGCTGCTGCATCTTCGTCGCTA
CCTTTGCGGGTTTTCTGCATAATCATGTATGAGAACTTGGAGCCCTTCTGACCATGCCAGCGCTTTGTGGTGGCCTCACGTGGGTGGTTCACTACCGGTG
AGCGCTGCACAAAGTGGCACCACGTGCTTCCTGCTGCTGGGCACTGTTAATATCAGACACGGTTGAGTTTGTGAAGCACAACAATTAATCGCATCCAACG
TCTTACCTCGAAGTGGTGCGGACACGGCGCGACGATGCGAATATCTTCCTTTCCATCCTCATCTTCTGCGACCGAGTCCAGCACAAACTGACGCGCCGAT
CGCACGTGGTGCGACCCCCACGGACTGCCGCGATCCACAACCACTAGACATCCATTCTCGCTCAGTAGCTCCCACAGCGCCGAGGTTGTCGCGACACGCT
CAAAGTCGTTGGTGATATCCGAGAACACGTAGCTCACCACAATGAGGTCATATTTGTTTCCAGCCTCAATGTCCCTCGACATGTCAGCAATGTTGCGACG
CACACTGAGACCTGGGAATCCTTCCAAAAGCACTTCTGCCGCGTCCACCATGGATTGACTGGGCTCCACCACACGATATTTGTCCAGTGACTCGTCGTAG
AAGTCCTTGGCTACCCAAGACGCCGTACCAGGACCAGCACCAAAGTCCAGCACGGACTTGGGTTTGAAGTCCGGCAGCCGCTTCTGTAGCTCCGTGAATA
CAGCGTGTGTACAGGCGTAAGTGGCCTCCATCTCGTAGGCCAGGTAGGCAAGCGTTTCGGCCGGTCCGTAGGCAAAAGGTGGGATCTGCTGGTTACGGTC
CATAGTCCAGCCCAGCGGCGTTTTGCTCATATCCAGCGGCAGTTGGCGAGTATTCCGGCGGTCTCCCACATGCTTCTGGCGCAGCGTCTCAAGCTGCGAG
TGCGTACGGCTGCGAACGATGGAGATAAGACGGCCCAACAGCTCCGTCGGCATCTCCACGCGCTGTGCTAGACCGTTGCGCGAGAGCTGCTCAATGTCTG
CGAGGATAGAAGGTGTGCGCGGATCGGGACTGGAAACCTTCGAGGCATTGGCTCTGCGCAGACGCCGAGCGCGGCGGTTGGCGGCCGGTGAAGAAAAGGT
GGCAGCCATCACAGAAGGAACGATGGCAGGCGCGAGACGAGAGCAGTACGCAGCGGACACACCGCGTGTAGTAAGCTTCCGCAGCATCATTGCCGACAGC
ATTGGTGGTGGTGAC