Description :
From Genome Similarity Track
Location :
Scaffold_337:8028- 12407
Sequence
4379 bases(100 bases per row)
CCCAAGTTGTATCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTCAGTGGCGTTCTGTCGTCGAGGATGGCCTC
GACTTCATATTCGCCGGCAGCTTGATCTGGTTCCCAGCTGTCTTCAGGCAGCAGCTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTACC
AACCGAGTGTTCGGTCGACTGCTGAACTCGTTGACAGCCTTGAGTCTCTACACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTCAGGCAGTTCCA
GCTCGTGCGCAAACGCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGATGAGCTAATTTCTTTGTCAAGCCCGGTTTGACGCGTTCCATGTA
CAGCCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGGGCTCTTGCACGATCTTCTATCTCTTCTGAAGCTTCTAGGGGGTCCGCCCAGTGTTCG
TTTCCACTTGGTTGAAGTACAGCAGCTTTTTCCAGTCGACTCTGAGCATCATTATGCTTTTTAGCCCTTCGCTCCTTTCCTACAGCCTGATAATCATTGG
CCATAGTGAGGGCGATCTCATGTTGTCGATTGATCTCATGCCGCCATGCTAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGC
CCTCAACGTCGACTGAGCATACCAACCGTGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTGATAGCAAATACTAGCCTCTCC
GCGATTTCGTCCCAGTCTTCCTGTAGAGGTCCTCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTAACGCGATG
GAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAATCATCGTTGTTGGTACCACAAGCCGCAGCTTG
GTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGATAACACGAGCCGGTCAGCATACTTCCAGGCAT
CTCGAGCTTCTTTGTAACTCAGCTCTTCTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCTGCTTCTCGTCTTGTGCTACCAGAATCCGTCT
GCGTCGTTCCCGCTGTATCGCTACCGGGTCAACATCTTCCGCATCGGGAAATGCCGCTGGTACAGTCCTGTGAAGATGGTCTGGCAAATCTTCGCCGATT
GAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATTCTGTTCTTGAGCTTTTGAGACCTCCTTCGAGTGTTCATCTGCAAACCTGACGCGTTTCTTGGCTT
TCGTCTGTCGCCGAGTCATCACTGCTATATTACCATAATCGCACTTTGGTGAGCTGTAATCAACCACGAAATTTTCGAAAGTTTTCCACTTTGAAGACTC
GCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTCGTGACGAAACATCTACCGAGTCTTCATCCGGCTCGTAGATCATTGTCTGGATGCGGTTCAGC
GATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATGACCCGACTGACTTTTGATTCCAGCGCTTCAGTGGCTAACGAATCCGCAGCAGCGTTGTATTCTC
GTACAACGTGGAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCC
TAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTGACACCGTTAATCATCCCTGTGTAC
TCTGCCTCATTCACCGTGGTGGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAATTTCCGTAGC
CACCGTAGCTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAATTACGGGAAAGCCTGGCGTACAGCAACGCGGGGTCCATTCGAAT
AGTCGGGGAACCCTTGTTTGGAGGTGCCACCGGCGCGAGCGAGTCTTCCAGGTCGACGAAGCTCGTGATGCCTGACTGCAGTAGCTGCGCAAAGGCGACA
TCCTTCTCCTTCACGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACT
CTAACGTCGAGAATCGCGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGC
TGGATGGTAGCTCATCTCGGCTTCCTTAAGCACCCGACCGAGGTACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCC
CATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATCTTTCGAAGGAAT
GACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCATCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTA
GTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCGGTGATAGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCT
TCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCA
ATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTC
GTCTGATTCCCCGTTCGTAAACATGTCAGCGACGGAGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTC
GTTTGAAACGAACCCTCGGCGCTTGGTCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAATGCATCCTTTCCGAGTATTCAAACCAACCCCTTTAGGTTG
AACGAACCCCCAGAGTGCGCTGTCAGTCATACGCTGGTAGATCATCGGCGCGTTCTTTAACCCAAAGGGCATGCGTAACCACTCAAAATGTCCTAGTGCG
CAGACGAACGCTGACACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAACCATACGTAGCGCTCGAGAT
CTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGGGATAGCATTCACCATCTTGTAATCAATGCAGAGGCGGATGTCCAGCCCGTT
CTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTATCCGAAAAAAAAACGATCAGTCCAGCTCGCAGCAGAGCGCGCAGCAGCTCGTACAGCTTG
CCGAGGAATCGTAACGGCACGCGTCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCGCCGTAGGCTGGCGGCGGCAGTG
CGTTGCCACTAGCAATCAGGATCTGCTCGTGGCTCTTTAGCGTCGCAACCAGACGCTCTCGGCGTTCAGTCGACAGCTC