Description :
From Genome Similarity Track
Location :
Scaffold_56:80257- 86489
Transcript NameFunction/comments
Phyra_508272-oxoglutarate dehydrogenase, putative
Phyra_81079glycerophosphoryl diester phosphodiesterase, putative
Phyra_81080Hypothetical protein
Phyra_50837glycerophosphoryl diester phosphodiesterase, putative

Sequence
6232 bases(100 bases per row)
AGTGGCTACATTAAGAGAGGTGGGGGCTGTGGCTGTAGATGGACTGTAGGCACGTGGCTGATGGACTGCGGTGTGCCTTTAGATTGTGACGGAGCTGCGT
GAACTTTTCTGCGGCCACATTGGACTCGAGTATCAGCATTTACGCAATCGCGACGCTGCGCTGTGGATCCGCGAGCGGCTTGAAAAGTACAAGGTTGGTG
TTTGCGTTTTGTTTGTTTGTTGTTCATTGTGTTTAACGATGTGGTTTCTTATTGCAGGACGAACCTCACAGTAAGGAAGAGAAGGTGGATATGCTACGCC
AAATGGTGCAAGCGGAGCTGTTCGAGCGGTTTCTTGGGCGACGCTTCTCCGGAGCAAAGCGCTTCTCCATCGAAGGCTGCGAGAGCTTGATCCCTGGCCT
TTGTGAACTGCTGGAGAATGCCAGTGATCATGGAGTGGAGGTCGTTCAGATGGGGATGGCTCATCGTGGCCGTTTGAACGTCTTGGCGAATGTGCTACAG
CGTCCGCTGCGGTCCATTATTTCTCAGTTTCAGCCATACCTTCCTGATGAGCCCGACTACCCGAACAATTCTGATGATGTTCGATACCATCTCGGGACAT
CCTCGATGCTTAAAATGCGCAATGGAAAGCAACTGGAAGTCAACCTGGCTGCAAATCCGTCGCATTTGGAAGCAGTCAACCCGGTTGTACTGGGCCAAGC
ACGTGCCTGCCAGACTCAACTGGGAGATAACGGCAGTCGGGTGATGCCGATCTTGATCCATGGAGACGCTGCAATGTTCCAAGGATCAGTGCGAGAGGCA
CTGGGGTTCAGCTCTCTGGAGGACTTTCGGACAGGAGGTACGATCCATGTCATCATCAACAATCAGATCGGCTTTACGACATTGCCGAAAAATGCAGACT
CTGCGGTGTATTGCACGTACGTTCACTTTTGAAACTTGCTGCCAAAGCTTGCAGTAGTTCTGATTATGGCTTTTGCTTTGGGTTGCGAACAGCGATGTTG
CCAAGGTATCCAGAAGTCCGATATTCCACGTGAATGCCGATGACCCTGAGGCGGTGGCAAAGGTGATGAAAATTGCTGTTGAGTTCCGGCAAACGTTTCA
CTGTGATGTGACCGTCGATCTAGTTTGCTATCGTCGTCACGGTCACAACGAACAAGATTCACCCGAAATCACAGCCCCAGTCATGTATCACTTCATCAAC
AAGCATCCAACAATCATCAAGCTATATTCACAGAAGCTCGCGAGTGAAGGTACGCTGCCGCCCAAAGACTACGCCAAGATGTGCTCCACGTTCGAAGATC
ATCTTGTTTCAGAGTATCATCACTCACGCGAAAACCACTCTGGATGGGATAACCCCGGTGATACGTCCTGGAAGACTGAGTGGTATGCCGACACCAAGAG
CGACATATCGAAGAGTTTCCCAGGTGACCTTTCAAATGCTTGCGAACTTACAGACAAGCCTATCTACGACCGATCGACGGGTGTTGATAAGAGCTTTCTG
GAGAAGGTTGGCGGTCAACTATTCCGAATTCCGCAGGGATTTTCGGCGCATCGCAAGGTCGAAGCCATTATGAACAACCGCTTGCGTGCAGTTGAAACTG
GAGATCGAGTAGATTGGGCAACCGCAGAGATGCTGGCCTTTGGTTGCCTGCTGGTGGAAGGAGTTGATGTACGGCTTAGCGGACAAGACTGCGAGCGTGG
CACCTTCAACCAACGCCACGCCGTTCTCTATGACCAATTCGAAGCCCTATCCGGGAGAAACTCATCGTACACGCCTCTGAACGACCTCGATGTAGATGGC
GTCAGAAGCTCGCTGCAAATGACTGGGTTGGAAAACGCGCCATGTGGACGCTTCGACGTAGTCAACAGTCCACTCAGTGAGGAAGGAGTGCTTGGCTTCG
AGTACGGGTACTCCATCCAGACACCGATGGGTCTGACGATCTGGGAAGCACAATTTGGAGATTTTGCGAATGGCGCCCAGACAATGATTGACACCTTTAT
CACTTCAGGTGAGCAAAAGTGGCAACGGCAGTCGGGTATTGTGCTCAACTTACCGCACGGTTTTGAGGGACAAGGGCCCGAGCACAGTAGCGCACGGATC
GAGCGTTTTCTTCAGCTAGTCAATGAAGACGGCGACGAGTTCACAGCGGAAGAGGGCATTGACGCTGCTATGACGCGGACAAACGTCCAGGTGGTGATTC
CGTCCACACCCGCGCAGTATTTCCATGCGCTCCGCCGGCAGATATCCTCGAGCTATCGCAAGCCGCTGATCATGTTCACCCCGAAATCGCTTCTTCACCA
CCGCCCATGCAACTCCGACTTAGCTGACTTGACCCTGGGAACGTCATTCCAGCGTGTGCTCCCTCCTCACCCCGATGACCAAGTGACAATGGTGAACGAT
GACGAGGTAGGCATCATTTCCTGGGGAGGATGTTTGTTGATGCACTTGCTAACTTGCTACACTGTCGCTTTTCTTGATTGTGTAGATCCGCAAGCTGGTG
TTGTGCTGCGGCAAAATCTACTTCCCTGTGCGCCATGGCTTGCGCAGCCGCGGGATCCGAAATATCGCTACGGCTCGTATCGAGCAGTTGGCCCCTTTCC
CGTTCCATGAGGTGGCCGATTGCATCGCACGGTACCCCAAGGCAGAAATCGTGTGGGTTCAGGAAGAGCCGAAAAACATGGGCGCATACGGCCACATCCT
CCCGCGGTTGCTGACTGTGCTGGAGCACCTGGGCGACTCTCGCGAGTTTTCCTACATCGGACGCCCCCCTTCTGCATCCCCTGCAACAGGCCAGTACGAA
ATCCACGTGCACGAGATGAAGACGATCGTCGATGAGGCACTGGCGTAAGATAGTTAGGCTCGCTCAGTTGCAGCAAATGTAATGCGAATTCATGAAGCTG
CAAACCCAGTATTGCCAGCCACGCATTTCGAGCGGGGACGGCCGTCTTGCAGTTGTCGGTGAACAGACCGTCGATGCCCATGTCGAACAGCTCCAAGTAC
TCGAGCGTCGCGTTGCCAGAGTAGTTGACGGCCAGACGGTAGTTCTCGTCTCGCATCGTCCACGCGTGCACCTGCAGTCCGACGGCGTGCGCGTCCTCGA
TCACGTTCGGGTACTCGAAGATGGTGTAGTCGGCGTCCGAGACCTGTCCGTCGCCGTTCGAGTCGACGACGTTGCCATCGGCATCCACCTCGACGGCGAC
GGCCTTGAGCAGGTACCTCTTCCAGGGAGACACAACGTCGGCGTACGTGGCCACCTCGGCCAGGCCCTCCGGCGTGGTGAGGTAGCCAAAGTAGTCCGTG
CGGTTGGTCAGAGTCCAGTCGTACGGGCGGTCGGACGGCGCCTGGAAGATGACCTCGCCCGTGAGCGGGTCGCTGTCGTAGCCGTCGAGGAGCTGCACCA
GCGTGACGTTGGTGAGCTCGTTGAGGTCGCGCAGGTTCTGCGTCTCAAAGGACTGGATGAACACGGGCGCGTCGGCGTGGTTCCAGCCGTACTTGGTCAG
CAGCTCCAGCAGCGTGTTCTCGATGGGGAGGCCGAGCGCCTTGTGGAAGCTCGAGTGCTTCACCTCCGGGTAGATGGCGATGGTGCGGTTGTACTCGGCC
GACTTGCTCTGCGCCAGCTGGATGACCTCCTCGAACGTCGGGATCTCGTACAGTCCGTTGTAGCTCTGGTTGCGCTCGGGGAGCGGCTGCACGGCGCGCA
GCGTCTTGATCTCCTCGAGCGTGAAGTCGCTGACGAAGTAGCCCTCCGTGACGATGCCGTCCAGCGTCTTGTTGGTGAGACGGTCGGCGAACTCGGGGTG
GTCGGCGACGTTGGTGGTGCCGTCGATGTAGGGCTCGTGGCGGACAACGAGCACTCCGTCCTTGGTGCTGACGAGGTCGGGTTCAATGACGTCGACGCCG
ACTTGGATGGCGAGTGTGTAGCCGGCGATGGTGTGGTCGGGCAGGTACCCGGGTGCCCCGCGGTGGCCGACGATCGTCGAGTGCTGAAGCGGTTTTGATG
ACAATGTGGAGATATCCGCCTTGGTGTTCTTATCGGCACCCCAATAGGCGATAGCCAGGAAGAGCACGCCTGCAAGCCCGAGGGTGGTCATGCCGAGCAA
TGGATCGTTACAGCAGTTTTAGTGAGCATGCGCACTGCTAATAGCACTAGCCCCACGTTGGCCGCAGCTCCTTGTTGGCAAAGTTACAGTGAAGACATGA
TGGTCCGGCATCGACACATCCACCATCCTAATCCATCTCTCTCCGAATTCGCCCGGTGCCATGGTAAGTGTTTGGTACGTCGGGGCGTTACTCTTGGTAC
ACGTAGCTTCGAGCGCGAAAGCTGAAGGTGTCTGCGTGTCCGCCAACGCCGCGTTAAACGGATGCCCGGCGGAGACACCGTTCTCGTTTACCAAGGAACG
AGCCACCACCTCGCGGCTTGCAGGTGACGAATGTGGTTCAGAAGACTTACCCGCTCTGGCAGAGAATGCCACTCCATTCATCGCCCGTCCAGCTTCCTTA
GTCAAGCAGCAGAACCTCATTGCTGACATCGTCAAGCGCACTCGTGCAGGTGGGAACCAGGTCTTCACGCCCTCAAGTACCGATGCACGTCAGAAGACTC
CAAACGGGGAGAACATCCTCGAGAGCTATGGATTGCAGCCAGTACCCACACCAGCTACCGGCAGTTGCCAATACTACGCAGTAGCTATGTCACTGCTCGA
CATGCGCTTCGACACACCGCAGCACGTTGAGGCCTTGGAGCGGATGACCCAGCACTTAAAGACAGGCATTGCCGAAGCAAGCCGCTACGGATACGAAGTG
GAATTTCCGCACGACATCCGACAGGCCATTTTGGCGAGCAATCTACTGGAAGTCGAAGGCCTGGAGCTAGCAGCGACCATGTCGGAGGAGGAATCGGATG
CGCTTTTTCAGGAGTACATTGACGCCATCGCGCAGTCACCGTCCGATATCGCTGCGTTCTTGCCGCTCGAACTGTGGGGCACAGAGGTCTCCCTCCGCAT
GATGGCGAAGCTCCTGCAACAACCAATTTTCGTGGTCATCGCGCCGTACGGCCTGCAAACACCCCCAAGCTACTACCAAGTCTACAAGCCCGAGCGGATA
GCAAGATCTGGACGTGAGCTGGACTCGGCGGAGGCGTATTTCATCCCCAGCTTGGAGCCCGAGCGGTGGATTGCTTGGCTTCGACAGGCGTGCGGATTGT
CCACTTCCACGGCCAACCCACCTATTGTGCTGCTGTACAGCCATTCCCACTACAGCCGAGTGCAGTTTGTCGGTACCCCCGCTGCAACATAAGAATTGAA
CAACTCCAAGCACTCAGCTTCCGGCGGATAGGTGGTGCAGATGGTAAAGTGATAAGGACGGCGTGTTTGTTGTTTTTGCTTTGCGTGTTCCTTGATCTGC
AAACACGCAAAGCAGTGACAGCTCTGCGGCCGTTCTCTATCGGAGAGAGACCGCCAGTCAGGCGTTCACGAGAACTGGAGCACAGCGATGCAAGTTGCAT
CATGCAACTTGCTGCAGATCGGAGCCTCTCGCTCGCTCGTCGAGTCCAGAAAACCGGGCAATAATAACCAAGCGATCATGTCTTTCAGGCTGAAAGTTTC
AGCGACGTGCAATCGCCTCGATCGTCCTCCAAGGTACCGATGCGTTGGAGGTCCATTGGCGCTATTACTTCGAAGCACGTTTGCACGAAGTCAAGGCCTG
TAGATTCCGTTCGCACACATGTCCTATCACTGGTCCCCGCAATTAATTCCTCTTGCATCTTTTAGTTTTGTCGGCATGTGGTACACGTGACCCGAGCGGA
TTCGGCTCTCCCCGGCCCATTATGCCCTGGCGCCCAGGAGATACAGTGTCTTTCAAATCACGAAAGCGATCTCAGCGCGCTGACCCCGGGCCACGGGCTC
ATGAATGCCAATCTTGACGCGGTTCCTCCTGCTGTCGCTGTTCATCTCACTTCCGAATTCCCCACCAAGACCTCCGCTATCTCCGCACTCCTCCGTCATG
GTTAACATTTGGTACGCCGGTGCTCTCGCCTTGGCTTTCGCTGCTACCAACGTCAACGCCGACGTCTGCGGAGACGCCTCCGTCACGCAGACGGAGCCCG
TGACTACCACCGCCGCCGTCACCACCACCGAGGGCTCCATCAAGTCGCTCAAACACCCGACGATCGTCGGCCACCGCGGGGCACCCGGGTACCTGCCCGA
CCACACCATCGCCGGCTACACACTCGCCATCC