Description :
From Genome Similarity Track
Location :
Scaffold_141:8024- 17040
Transcript NameFunction/comments
Phyke_g4962hypothetical protein
Phyke_g4963hypothetical protein PHYSODRAFT_262149
Phyke_g4964hypothetical protein PHYSODRAFT_508739
Phyke_g4965hypothetical protein PHYSODRAFT_509038
Phyke_g49662-oxoglutarate dehydrogenase E1 component, putative

Sequence
9016 bases(100 bases per row)
CTGTGGCTGTGGTGCGTACATCTCATGGCGCTACGGCAAGTACATATCGGGGACAGCAAATGCTAAGCACGGTTCAGGGCAAACGCCTAGAAGTTACCAG
CCTCTGTGTGCTGCATGACAACGAGAATGGCGTCGTGCCTCCTGGATCGGTACGCCGCGTGCAATGAAGATTTCATTGTTTACTATTAGCGGGCTGACAT
ATCGTTTCCACTTGCTGTTCCTTATCAGGTTATCTACACAGGATAGCGACAACAATGTTATCGTCTTGTAGATCGATCACAGTTATCTTAAAGAAATTGA
AACCATTCGTTCTCGAAGAGCATGTGCTTCGGCTCATAGATCTAATCGCGATGGAGAGTAAAGCCCGTGCCGAGTTCAATCTGGGAGAGCTCCTCTAGCA
CCTGATTGCCTGCGAGGATAGGCGGGTATTTGGCTAAAGCATCAGGCGTTGCAAAGCGCCCCAGAGGTTCCAGTGTTTTGTCCGATGCCGTGTGCGAGAA
GAGAGTGGAGGACACACGCCAAAGGCTCTTACCAGCAATCTTACGCTGCTCGATCTTCTCGATTGTCGTGTCCGCCACAACCACCTCGTGAAAGCCCGCT
TGCACGTATCCACCAGTCAGGTATTCCATTTGCTTGCCCGCCTGCACCAACAAGCAGCCATCAGGGATCTTCACAGCCGTTCGGGTACCATCTCGAAGCC
AAATGTACAGACCAGGGAAACGCGACTTGCCATGAATGGTTAACAAGTTCAGATCTGCAGTAGGACGCCAAAAACACCAACAAAACGTGAATAAATTCCT
TCCTCCAAACAAACCCCGCACATTTTCCCCATTTCTTACCGTAGTGATAAGCCGCAAGCACGTCGTTCAACTGGTTAAACACATTAAAGTTGCTACCCGT
GGGCGCGAGCAGATGAGGCCCGTTTTTGATGCGGTCCACCAGcgcgtccttctccagaCCAAGTCCAACCGCAACGATCTCCACCAAGTCCGTAATGGCA
TTCAACATTTTCCCACCCCACATATCCATGATGCTTCCCCACTCTGGGAAGTTCTTTGGGATCACTGGCTCAGCATTCAGCTCTTTGAATTGAGTATCCT
GAAAGCAAAAAGATTGTCAACCACTCCAGGGATTTTAAACATAGAGGCCACTGCATTTAACTCACCACTGGACGACCACCAACACGCCAAAAGAAGCGAC
TCTTCTTGTCTGCCTCAGGCGGACACAATGTCACTGGAGCGTACCGCTTGTCCAGCGTCGCTGCACGAGCGCAATGGTCACGTGCACGCTCCTTCCGTTC
GGGGGTAACCCCAACCTGGTAGTGATACTGCGGACGAGCGTCTTCCTCAAAGTCGGTGGACTCGAAATACCGCTCCATCATATCTAGGAACGTATCATTG
TCATGGTCGGCTGCACGCTGATCAAATGCAAAAGCAGTTGACGTAGTTTACAGGTTAAACTGAGATCATTTATAATGAATAGAACAGGTAAGTCGCCTAC
CTCATCGCGGACGCAGAGCACGCCAAATTTGTGCAGTGACTCGGCAGCTTTCTCACACTCGGCCTTGTCGCCAGTGATCTTATAGTGCTTGAGGTCGATC
ACGGGGATTTCGAGCATTGGGGGCGACCAAAATGAATGTGAAAATGAACAACGTTTCGGCGGTCCATGTGAGCCGCTAAGCGATAAACCTCCAATATTTA
ATTTGTACCACACAATTATTCCAATTTTCAGCTCATAATTTACTCAATAAACCCTTAATATCGTATGTGTACCCTTTGAAAGCGTGGTAAGTATGCGAAC
GCATACTCGTTCATATCTCGGATGACAAATGCGCTGAGAATTCGAGAGTGGGAATTATAAGGGCCTATGCTGAGAGTCTGGGGTCTGATCTCAGCGATAT
CCTGCCAAGATGCGGATGAAATACTGGAATAGCAAAGACcagcgtcatcttcatcactggcaTTGGTTCGGATTCCGAAGGAACGGGTAATGCGAGAAGT
ACTTCTGTGCTAGCGACTTGATATTTTTTCGTCATCGGGGGAAGAGTGGCTGCTGTTCTAGCACAACATCATGTAGCGTTACGACACCCACATCGGATCC
ATCCCCAAAGAGGTCTCGACGAAAGGCTTTTCGGATAGCTTGTAAGCTCAATACCATTCCTTCGGCTTGAGCATGAGCATGTTCCGAGTCCAAGGCGCTG
TAAGTTGCCTGCAGTTGCTTAACCACATCCTTACCAAGTCTATCATACGCACACTCTAGAGTACTTGGGTGTTCTCTAGCTATTCTTTGGCGTTTGGGCT
TACGCTCATGGCAAGCTTTGGGTGACCCCCCGCAACACCTCTTTGTTGAGGCGATAACGCTTCACTGACGAACAGATTGACTTTCCATGCAACACAGACT
GTAGAGCTGTTTCCAATGGAGGAGAGATGACCACCGACGGCAAGGCTGTAAGCATCTTGGTCACTAAGCTGACGCATGTAATTCGTCCACTACACATGTC
TCCACGCACAGCATCTCGCTATGACGCTATGTGGGGCGAGGGCCCTGGGCGACGAGACTTCTTCGTGGCCACTTGCTCCGACAGCACCACTATTCACTAT
TCAAGCAAGAAGTTCTACCGTGACACTAGTTACACACAAAGTAACAAGACGGTTCGGCACAGGTACGACACAGCAGATCCAAGGGTGACCGAAGCAGTAC
ATGGGATGCCAACTAAAAAATACCTGCTCGCTCGGCAAGTTACAGACTTACGTCGCGTTCATGATTCCACGGCTCGATATGCTGCTCGACTTCTCAATTC
GGAAGAAGTTCAGAGGTCTGAGGTTTAAACGCTATTCGCaagcgcgcaagaaactACATCAGTTCTGTGGGCTCTTCGTTGAGAGCTGAGGCGCATCTCG
GACAATTGTGGGCTTTGGTGGCTGGAACTGCATAGACTACGgtggattcatcaagaaatgCCCTGGTGGACCTTCAAAGTGTttggagagagagagagag
ctgTAGAAGTACTGTCACGTGGAGActgaggacgagtaccgcaccagtcgtgtgcattacGGGTGCACCAACAGGAGGTGCCCAAGACctctcgcagcaa
tatcagcgtcgtgagtaccgtgatggtgtggtgcgctcgcggaaagtttactctgttctacaCTGCAAGGCATGTGGAGCTACAGTCAACCGCGGTGTCA
ATGCCTCGTGGAACattttgctgatgttgcaaCGCTTACTGCGCGGTCTACCACGTCTACCAGCTTATCACAGGACTCAACGAAACTAGCACAACTTAAA
AAAGTTGTTCTGCTGTcgtcctagacggttgtcagtCAGATCGTCGCTGGTTGTCCTCGCGCTGGTAAGAGTTATCGATCTTGTCATAGCTCTAGTGGTT
GGGTAAGACATACCTAGTTTTTCAATCGGAGCACAGTACGAAACAAACACGAGTTCCTCACATTATTGAACACTACGCTTATCAATAAAGTGCTATCCGG
GTATTTGACGACGGATCTGTCTTATGCCTCCGCCAACGGATAAGCGTTTTGGAGCTTTGGCAAAAAGTGACCGTCGCTCATGGGCACATTGGCACTTCCG
TGGTCCGTATTGTTCAGTGCGTACTGCGTTGCGTCGGTGAGATCCTCCCACATGATCAGCGCTTGGAATTCTCCAGACGTTGTTGTGCCCTCCAAGTGGT
GGCTGATGAAAATCCAACTGGACGTATACCTTCCTCGACCTTGAAGCTAGTCCCATTCAGCATGTCGGCGTTCAGTGGTGCGTAAGTAGAGTAGCCTCTG
TGCGCTGATGGTGTCACGGCTAAAATCTTTTCCGGTAGATTGGTAGGATTGTCGATCCACACAGTAATGTGCTCCAGTTGTGGCGGTGCCCAAAACATGT
TACTGGGCAGTCGTTGGGGAAATACCGCGAGTACATGATAGCCCAGACGCCATTGTACCACGTCGAGCGTCTGTAGACTTGCGATCCCACGTCGGAACCC
TTACAGCCTGCGCTTGCTGATCCTGTAGGCTTGAGACCACCGCTAGTGTTGCCTGCGACATCCACAGCTGGTAGGGGTGACAACCGTAGTTGATGAAAAT
CTGAGGCTGGTAGATAACTCCTGCCACATTTGTGATGGAGGTGGGGTCCGATGCTGAGAATGGGGCCACTTGGTCGTGGTTGACCCAGCCTGCTTGAACT
AATGCAAGTGAGGCAGCGAAAGTGATGAGTCCACGAATGTTCATGGTAGCTTGGAGCTTGAGAGACAGATTCGAAAGTGAGCAAGGCGGTTCGTGTTTTC
GTACTAGCTTTCATCGCCGTAGTATGACGATACGATACAGAAGAGTAAATGCTGCAGTGTTGTAGGCTGCAGTAAAACAATAGCGTAAAGTTTACACGGA
GGACTTGATTatgcagatgcaggagaGACATACATGTTATGCTAGTGCGCGCAGAAATTGGTGGTGTTGGTTGAGCCGGGCAGTAGTTTTCCGGAAGTGC
GGGGCTTACGCACTGGGGGAATTGCGCTCGCGGACGCGCACGGCCAACGGGCCCTTCACTGGTAGAACGAAGGAAAAGTCATAGGTGATCTTGAACGGGT
CTTCCACCGTCTCAATATCAAAACGACTAAAGAGCACAGCCATGACCACCTTCATCTCAAGCATGGCGAGGTGCATACCGATGCACTTACGTGGCCCCGt
gctgaaggtgatgaaTTGTGGAGGCGTGATGTTCTTACGCTCACCCGTTTTATCGTCGAACCAACGTTCAGGTCGGTACTCCGTAGCGTCTTCTCCCCAC
ACGTTCTTCCTTCTGGCTGCAGCATACTTTGAGACGACAACGACGGTGCCTTTCTTGATGAATGCGCCGTCCGTAAGTGTTGTATCACGTGTCGTGCACC
GATACGTGGATACTGACTGCAAGCGCACACTCTCTTTCACCGCGGCATCCAAGTACACGAGTTTCTGCGTGTCGTCGAGTGTCGGTGTCTCAATTTCTCT
GGTCAAAAGCCCCGGCAACACCGATCGGATTTCTTCACGAATCTTGTGCAGAACACGCGGGTGTCGATTCATCATCACGATGAGCCATGACAAACTGAAG
GATGTCGTGTCTTTGCcggcgatgaagaagttgacagcTGTGTCCTGCAGTTCTCGTGGGTCCGCATTCGGGTTACCTctcatcagcagcgtcaaaaGAT
TCTTCTGCGCTGAATTGTCATTCAACGACCGGACCATGATCCCACGTACCATGTCGTTAACAATTTTCATGTTGTCTCGTAGACGCCTTTCAGTCCCGAT
ATTGAGGAAACGTGCTAGTTTCCACATCCACATAGGGGTCTGGAAACGGTTCTGCACAGCGTGCAGCGCGATATCCAGCGGGTGCATCTCGtccacaaga
acatcacCGCCCAATTGATTAAGCTCTACACCAAAGCCGATGCGTGTGAACACATCGCTCGTAAACTTGCCCAGTAGCGACTTCATGCTTACGACTTGAT
CACGGTCAGCACATTGAGCAAGTACATTGCGAAGTTGCAGAGCCTTATCGCGGATAACCGGCTCCATGATGTCCCGAATGCTGCGTGTGGAGAAGAGGTG
ACTGGCCGCTCGCCgttgctgcttccacttgtcTCCGTTGGCATTGAGCAGTCCGTTACCGAGTACATCAAACGAAATGTCCCCGAGCGTACCTCCTTTC
TCGAACACATCGAATTGGTTCTTGAACACGTCGTTGAGGTCACTAGGCATAGACAGCACGACCCAAGGCGGttggaacagcagctgaagcatCCATGGTT
GACCGTTGCTTGCGTCGGTTTGGTCGTTGATCCAGTCGCTCATTCGGTAGCGGTTGAAGAGTAGAACGTCTAACGTGTTGCCCAGAATTGGCAGCGTCGA
GGCCGGACGGAAGAGGGTTTCCATGCCTGGATCCGGCAGCGGAACCGGTATGTTCAGGAGCTTCCACGACGCGTAGATGGCGGTCAATGCACCAACCGCC
AGAAGAACTGTCTGCTGGGCTGCGTCGTGACTTTTACTGGACCACATTGAGTTGGTTGGGGGTGGCTGATTGCGTTGCTGGTAGTAAATTCGGGAATGGC
CAGACAACGGAAGCACTTCGTTCTTGCCAAGACGGTCACGGCAATAGCAGTGCCCAGAGCAATTCATCAGGATCACAGACAACTTTGATATATTCATTCG
GAGATCATCAGCGATGCGATCGTCTCCAATAGGGTAAAGTCTTTAATCCCGAAGATGACCCGAGGTGAGCTTATGACTCTCTTGCAAAAAGAGCTCATGG
AGCTTTTGTAACAGAAGTGTTTGACTTTGAGCCAACGATTGCACCAGCACTTACAGTCATAAATGAGCTTGAACTTCGTGGCACAAGTAACATGCCGTCA
CCTCGTTCGTATCAAGTTGACGAtgaacttgtccagcgtgGCATGGAGTAATCACAACGCGAGGAGCCTCGACAATCGCCCAAACGTCGTGTATCTTCCT
TCTCGGCAGTCGTTATCCAAAGATTCAAGTCATGGGGAATGCGTGGAGCTACTACGCTGACAGTGATGTGTTTGACAAATCTGCGTGCTTATCGTCGGGT
GGTGCATCGCACTCCTGCTCTGCATTCTACACGTCATTCAGACGAAGTGCCGCGAAGGTggttctgcagcaggaggCGTCTGGCTTAACATTGGAGCGAG
AACAGGTGCAACTGGCACTGGAGAATTGGGTCGGTGAGGCAGCTATCCTGTATGTCCCCCGCGAGGAATTCCCTGTTACTGTGGCCATGCCAGAAGAACT
ATTATTCGCTGTGAATGCCCTTCGCCAGAGCCCTAAAAAAACCGATGATGGTGTTCCACTCACACTGGAAGAAAATATTCTCCGCGGACTCTGTGCCAAC
CCGTTGAGCACACCTGATAGCATCTACAAAGTGATGGTACAACTCAGCAAACGCCTTCGCGGGGATGAGTTTCTGCGAGTGGTTGGCAAATAcccacgag
cagctcgactGTTCTCCAGTCAGCAGTTAAGTTCACGTTCTGATGTACACAGCAGCTTTCGGATGGCTATTTTACAAGACAATTAcaatcaagcagcagc
attggtgGGCAAGGCAGCGTACAGTGATAGTGTGGTCGAGACGAAACGTGCTCGGTTAAAAGAGATGTccaagctgcttcaagccTCGTTGGATAACTCC
ACGCCTTCCATCACTTCAGCACTCTCGTTGAGTGCAGACGAGGCCCATTCTCTTTCAGTATCTCGATCCAAAGACTCATTCAACCTTGCAATGACTTCCG
AGACGCTCGCGTTGTTTGAGACACAGCTTACTATGGAGAAGACGTTGGGGTTAGCGACTGGACTCCTAGTGGGGAGCTCCTTAGTGGAGACCATCCAGAA
GTTGGTGACAATGCACCCAGCGCATCGAAAGGCTCTGATGCTTGCTGTCGACTGTGCTGAGCAATATCTAGTACCCCCTCGACAATTCTGGTGGACTTTG
CTGCGTGTTCTCGCGCGTACAGACCAGTGGGAggcgttggtggcgttggcaAGTGCCATCCGACCGCCCATCGGGTATGTGGCCATTGTGGAAGTGATGC
TGGACGATGCCAAAAAGGAATTGGCTCGAGATTTATTGGATGTGATTCAAGATCCCCAAGAGTTAAATGACGTTGCTACACTTTTAGCTGAAGACCTCCA
AGAGCAAGTGGATATACTGTGACTTCAACATAATGATACGTGGTGCTATCATTGAAGTACAACATATGACATACCCCTTCAACAAGCAATTCCTCCAATC
CGATGTTTGGACGTCAGCCCCAACTCAACGGCGCTTGAAGCTCATCACTATTCTATTTGATAGACTTATGTCATATAATAGATCAAAAAAACTATATTCC
CCATTTTTGTTTTATACTCTATCACAGGTTCATTCCATCTCCAAGTTCCAAACAACTCACCATGATCCAAGCGGTCATTCGTCATTCTGGTCATCACCCC
GCAAGTCTCCGATGCTACGTCTCTCCGGTGCTTTGGCTCACCGCTGCACCACTCCTAGCAAGCGTCACGCTCTGCTATCGAAGGTTCTCTTCAGCTCCGC
TGCATCCCTTGAAGGTCTCGCAGCACAGTCCATGGCCGTCGCATTCCGCCAGTCTGGTCATCTTCAAGCTGATCTGGatccactgcagctccagccacGC
GTTGCAGTCGCCACTTTGGCTTCCGACAACTTCCAGGCGCTGCTCACTCGGCCATTGACTGCTGCAGACCTCAATGGCGTCGTGTCACTGCCTGCCGCCA
ATGGGCAACAGCTCTATgacgagctccagcgcgTGTACTGCGGCAAAACAGGCTTTGAGTTCGAGCATCTGTCGTCTGCGGAGGAGAAGCAATGGTTAGC
TCAAGCCGCAGAGACTTTAGACGCAGTGGAGGTATCACCTTCAGATCTACGCAATGCGTACTCCAGTATGTTGCGTGCGGACGTGTTCGAAACGTTCATG
GGCAAGAAGTTCGCGTCTTTCAAGAGATACTCCGGCGAAGGAGCCGAGtcaatgctgccagcagTTGAAACGGTTTTGCAAGCTTGTGCTAATTCTGGCG
TGTCGGATGTGGTGATTGGCATGCCGCACCGTGGACGATTGGCATTGCTGGTCGGATCGCTGGAGTATCCTGCACACAAGATCTTTCACAAGGTCAAGGG
CTTCTCGGAGTTCCCGGAGAATTACCGTGGAATTGACGACGTGTCGTCGCACATTGCTACGTCACTGGACAAGAAGTACGCTGACAAGAAGGTGCATGTG
TCGCTCCTGCACAATCCGTCGCATTTGGAGATTATCaatgctgttgcagcaggaaAAGTACGAGCTAAGAACGATGGTGATGAGAATACGAACGCTATGA
CGCTTTTGCTGCACGGTGATGCGGCGTTTGCTGGGCAAGGTTGTGTGCCTGAAGCGCTGGCGCTTTCCCTCCTACCAGATTTCGAAACCGGTGGGTCGGT
GCACGTTGTGGTGAAT