Description :
From Genome Similarity Track
Location :
Scaffold_61:80234- 90745
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16957hypothetical protein

Sequence
10511 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAAAAAGTAGGCACAACAAAAAAATAATAAAATGGGCTCATGGAATGGGTATTTTTTGGCTGTAAAGAAAGAATTAACATGTACCGTACCGTAAGA
CGTCGCCTGTGTTTACTTGCAGATGATAATAATGGCAGAATTCAATGAACTATGTGTAATTCATGTAGTAAATCCGCCGTGATTCGTATATAAATCCGCG
GTAAGCTGGACTATGCTGAGACGGGCTCCAAGTCGTGATAGTACGACCTATTTTTTGCCTTTCTTATGAATCTCTTGTGACGCTGCAGTCGTGTGGTGTG
TTCCAGTGTGCCTATTGGTTCGCTTAGTACACAATTTGGTGCATGCCACCCACTCCGCCGGTAATGGTTTTCGGCTTATCTTCGTGATCGACTTTAAGAT
TAAAATGGCATCATGGGCTCTGTATATCCGATAGCAGTGAAATTCAAAGTACGGTATGGTGAACTTAAAGATAAAAATGCACATGAGCAATACTGGCTAG
ACCAGCAGCGCTATTGTCGATGCAAATCTGGTCTAGCCGTACTATTATCCGTATATGTACAGCCGTCATAAAAACTAGTCTTATTTGAATAATTATGAGC
ACTATCTATAAATTTAATCCGCCTGGACATACAATATATTTGCATATACACAAATAGTATTAATTACATTACGAACAGATCACTAGAAATATGATAGGAC
TGCAAATGATCGAGAAGCTGATCTTCCATTTCTCAATTTCCACAATCGTATAGCTTTGAACATATAGCACTATCTTCGTATAATGATAAATGTCGACTGC
AGACGTCCACGGCCTCGTTGATATTGGCTGCACCTGTGATTGCATAGCTTCCAGCAGTGAGGCTTTCCAAACGTTCAACCGCTATGCCGCCTTGAACTGT
GACCCAATTTGGAACTGAAAAAGGGTTCATCAATGCATCTTCAGATTGTAAGGGTTGTGGTGTCAACTACAAAAAATGTAGGTTCTTTTCTTGTTTTGGC
GTACCGTTTCAAGGTCACGCAAGCCTAGCCCTCAATTTTACAGACGAAGATAATTGGTGTGTCCTCAATATTTATAGCTAAAGTGTATTATGCAATACCA
ATGCCAATACCAGTACACGAGCGTTTGCAGCAGAATACCCATCACCATACTCCTCAAATCGAAATGCTTGACGAGGTACCGTATCCGAAAGGAAGCGGGA
AGTTCAAAAGGCAAGTTAGGATCATTCTGCATTTTGCAGCCTCGAACTCACACGCGCTTGGGTAACTTCCTCAAACGCTTCGCGGGTATCTTCCAGCCGC
GATCTCTTCAATATGATCCGATTAAGACTGGCACTCATCGTTTTGACAGCCATTGTCAGTACCACCACCACACAAGCCATCGATTGGACCTTTTGGAACG
ATGACGACGATTCGACTCCTTCACCCGTGTCGTCCGATACGTCGATATCAGAGACCCTGTCTCCAGAAACGCTGTCGAATATGATGGGGTCCGATTACAT
GGACAATGTCAAGTCTGTGATTTACTCTGGAAAGGGGTCAGACTCGGACTCGGACTCTGGTTCGTTGCCTGATGTCGGTTCCTCTTCAGGTTCGGCTTCC
GAGCCGCCTGCTTCTTCAGCATCGTCCTCTGCCTCCTCTCTCGATACGGATGATAACTCTGCATCGAACGCTCTGTCGCTAGCTGGTTCTTTTGGTTTGG
ACTTGCCAATTCCTTCAATGGACGAGATCGCGACTCCTTCAACAGCCGTTACCAGCTATAAATCGACCTACCGCAACTGGGTGGGACCTTGGACTCAGTC
CTCGGATGCGGCTTGCTATCGCGAAGCTCACTTCATGAAAAAGTGTCCGAGCAACTATGACCGTAACGAATTAACCAACACGTGCTGGACGGAGTGTCCG
ATGGATTATCCCGTGGAATGTGGCATGCAGTGCATCCAACAGAACAATGACTGCGGTCGTGAGAACGCTGCCAAGATTTCTGCCGTTGCCATGTCCGCCT
TCAGTATGGCCACCTTTGGCGTGTTCGGCCAGTTGGCCAAGTACGGAAAGCACGTTAGCTGGGCTGTCAGATGCGCCAACTACATGATGGTCTTTGTGAG
AGCTGTCGTGCGTTTCACCCGCAACCAAATGGTTTTGGAGCCGCAGACATCACAAGCAAAACTTCTACTACTGCTGTACCAGACCAACTATGTCGTTAGT
GATCTTCCAGCTACGATTTACGCGTGCTCGGGCAGAAAAGTTCCGGCTGGTCTCCAGCTAACACGTCGGCTTATCCGCACCGCTCAGTTGGTTCTACAGC
TGGTGATCACCTACGATGATGAAATTATCGAAAGTTGGGAGAAGTTCAAGGCTTTCATGATGAAGGCCAACTTCACAGAAGCCGCAGAACAAATTACGGA
GGGAGAGATCTCAAGTCTGGTAACGGCTATGAAGCAGAACTCCACATGTGGAGACGACCTCAAGACGTTGACCAACCAGGTCTGGATGACGGTGGACGAG
TACAGACAGAAGGATCCCAAGATCAGCGAGTCCGAGCTACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGGTTTCGGTTTCAGCAACGTGGGGGAACCAATGTACACGCTTCATGAATTCGTCTT
CAATACCTAGCAAGACCGACGGTCGTCACACTTTGCTGTTGACGCTCAGAGCAGCTGTACGTGGCGGTCGGGTAACGACTCGGGAGTCTTGATCGAAGGA
TGAATGATTCGTTGCGGAACGATGTCTTGAAGTTGTACAGTTTCTTTTTTCTTTTTGCCCGGATCTGTATGTCATCCCTCTCTAACTCGCAAAGCTGGGC
TTGTGCATTGAAAGCGTCGTGTGAACAGCTATTCAGTGACGCGGCCGGCGCTGGCAAACAGTTTCTGTGATCTCATTGGTGTGTACGTCTCGATTATCGA
TAGGCGAAAAGCGCTACCGTGCTCACCCTAGACCAGAAACTGTGGCCTGAGCACAAAAGATCGACAAAGTGAAACTGTATATAATCTAAACAATTTAAAC
TGTATTAATAAACTATCTATTATTTATATAATAGATAGCTTACAAGTTTAAGGCTTAGATAAACTGCATTGCCTGTTCGGTCGTAGAAAATCGTTTTTCT
ATGGGATAGTGATGGTCGAATTGAGATACATGGTGCCCATGAATCGATACAACTCGTGAACTACAGGGGCCATTTACAATATACTTACATGTTAGTCTCT
CCAGTTTTTCTGTACTGCATGCTCTGTTTGTACATGTCATTCCGGTGGTGGAGACTAATCATCCGCCAAAGTTAGGTACATTTCTTTTTTAAATTCAAAT
TAAAATAGTTCATTAAAATTGTTTAACACAGGTAGTATATAGTATGCTTAACATCACCACTGACTATTGTGCATTCCTGTATGCTGCTAGCTTGAGGCGA
TGAATTCAGCTGCTGCACTGGGGACAAAAACATTTAGCGTTATGCTCTGTTACGCGCTTGGCCACATAAGTGCAGCAAGCACAAAATTCCAATTCAGACT
AAACAGAGCTCGCTCCAGCCCCTATACAGTTAAAATGAAGATTATAATACCGGTCTACATGTATTATATCTTGATTTTTGAAACTCATACCCCACCACCA
AATTCACAATCCCCCCCAAGAGTTAATCAATAAACAGTACCACTGAACAGGCCTCCTCCAGTCGTGTAGATAATGCCACATTTGCGAGGACCAACCTCGT
ACAGATTTTTGCTTTTGGTATCGTGCCGTGGACACCTCCACAAGAATTTTAAACCTTCGCACCGCCCAAACGATATCTGTTTGTGCCGAGCAGCGTTCCT
AGGAAGCGGGTGGTACGTGATGAGCTGGTACGTCGCACGATGCTGTGTTGAAGCAGTTCATGTATTCGGTTCAAGACCTCCGTCTTGGTTAGAGGGCTGT
AGTACATGTATTGACTTCAGACAGGACACAAGTCCGACCACCAAGACGAACAACCAGACCCTATTCGATAAATGCTTCCTCCACTCGAGTAGACAAACAC
CAGCCCTTCGCGCGAGTCGCGAGTTTACTGGGCACAGATTTTCGGCGGAAGTATCCTCCTCATGGCCTCCTGCCTCGACAATGTTGCCAAAGATGGGTTG
AATTACCAACGTGGCGATTAGCAAATCTCATCAGTCAAAAGGAGATCAGTAAAAAAAAAAGAGAGCAAAATAAAATGGGCTAGTTGGAATGAGTGACTCT
TATTACTCATTTAGTAAATGATACTATTATGGAGCTTCGATTCGCTACATATATTCATGTAGTAAGCCCTCAGCTTCTATCTGAACATATATATTCGAGT
ATGATTGGACTTGCAGAGGTTGCTTTCATTTCGTGGGGTACGAGCTCTATACAATCAGTACGATATCCATATCGCATATCGTGGAAGATCTAAGAAAACG
AAAGTACGGCTGCAATGGCAGTGCCGTCAACCGTCTATTGCGATATCGCTTGAGATGTTACCCATTTTGCGACTGAAAATGAGCTAAAACATCAAATCCT
ACGATTGTGAAGGGAAGTGTCAACTACAAAAAGTGCTGATATGGTACACGTCAGCCAAAAAATGAACCCAGTCAAACTTTGAGAAAGCACGCTGGCAAAC
CACCCTCGTTTTTACAGATACATGCCGTAATTTTGATGTATTTAGCACAAATGCAAAAAATGAAAGCACTGTAACGGCACTTCGTGTACATGCTTGCAGC
ATAATACCCATCACCATTCTTCCTCAAATCGTACTCCTCAACGAGGGAACGAGACCTCGACCGGAACCGGGAGGTCAACAGGTACGATAGGATCATTCTG
CATTTTGCAACCTCGGACTCACACGCGCTTGAGCAACTTCATCAAACGCTTTCGCGACCATTTCGATATGATCCGGTCAAGACTATTATTCTTGTTGGCT
GCTATTGCAACCACCAGCACACAAGCCATCGATTGGACCTTTTGGAACAATGACGACGATTCGACCCCTTCACCCGCGTCGTCCGATACGTCGATATCAG
AGACCCTGTCTCCAGAAACACTCAAAAGTATGATGGGGTCGGATTATCTGGACCGTGTCAAGTCTTTGATTAACTCTGGAAAGGGGTCTGATGTCGGTTC
CTCGTCAGGCTCAGCTTCAGAGCCGCCTGCTTCCATAATTTCGTCATCTGCCTCTTCGGACGATGACTCTGCATCTACTGCTTTGTCACTGTCGGGATCC
TCTACTTTGGACTTGCCAATTCCTTCAATGGACGAGATCGCGACTCCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNN