Description :
From Genome Similarity Track
Location :
Scaffold_64:80233- 85553
Transcript NameFunction/comments
Physo_138493pol protein
Physo_138494hypothetical protein

Sequence
5320 bases(100 bases per row)
GTCGACGCACCCTTTGTAACGAAGGGCTCCGCCAACAACAGGCGTCGAGGTGAAGAAGGCATGTCGGCTCCGGGAGCCGACGCTGCAGGCGGCGCGGACA
GTTGCAAACGTCCCGCACCGGAAAAACTTGCATGCTGTCATGCAGCCGGGCTGCACGACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCC
GCGGGATGAACCCGCCGGCGGTACTGAAGAAGAACGCCTGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGA
AGACGGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCCTGGGGCCGAGAAGCTACAAGAAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACATCG
AGGCGTTGAACATCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCC
GGTCATGAGCTGGAAACGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACATCGAGAGAACGAAGAGCGAGAATGAA
GTACGGATTGAGGCGAAACTGATTGGATCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGAGCGCGTAGAGCTGGGACTCGTTGAAGA
CGAGTCCCTACTACGAGATCTTACGGGAGCACGCGGACGTGCTTCCGGAAGAGATCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAAATTGA
TCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCATGGCGATCGACGACTTCTTTGAGAGTCGTCGCAAAGCT
GGACAAGTGCGGGAATCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCATACAACAAGCTGA
ACGATGCGACGATACCGGCGCAGACACCGATACCTCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGA
TGGGTTCTATCAGATCCTCATGCATGAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGT
CTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCATCGAGCTACTTCGACGATGTGTTCGTCCACA
GCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCGTGCGCAAACACAAGCTCTATGCGAACCTGAA
GAAGTGTATCTTCGGGGCGAGCGAGATACTCGTGCTCGGGCGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATTAG
TGGTCAACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGTCGCGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGC
TGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTT
GGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTTCACAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGAT
CGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGTTGAGCGCAACTACCCGGTGCATGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCGAAGT
TCCGAGTGTATCTACTCGGAAGCAAGCCGTTCGTGGTCTATATGGACCACGCGCCGCTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGC
GAGATGGCTCTCATTCTTCGCCGAGTATAACTTCCGGGTTGAGTACAAACCCGGAATACTCAATGTGGTGGCCGACGCACTCTCGCGTCGACCTGACTAC
GTCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCGACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACG
CGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCATCAGAAGCTGCCGAAGCGTCTTCGTGCTCGTGCACACCGTTACCGGGT
GCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGTCGTACCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTAT
CACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCAGTATAACTGGGTGCGCAAGT
ACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACAACCAACTCCACGGGAGTGTTGGCAGTCCAT
GTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCG
GTACCCGCTGAAGTGACTGCGAAACAGACGGCGCGTCTGTTCGTTGACATGGCGTTCAAACACCATGGCATGCCGATCGACATTGTCTCGGATCGAGACC
CGCGCTTCACTGCACACTTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGA
GTGCGTTAACCGCGTGCTCGTTGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGTCTGCCGATGGCAGAGTTCGCCATCAACAAC
TCGGTACATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACCCGGGATGGTGGCTCCTTCCTTAAGTG
GGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGTACAGTGTCAGCCGCGACTACGCGCAAGAAGAAGAAGAAGCGCGCGTC
TGTGCAGGGCACAGACGCCGACAAGAGCAAGAAGAAGGAGAAGAACGGGTCTGTGTAGGGCACAGACACCTCGAAGACGAACGCAGAGGCCGGGCCTACT
GCTAGAAACGAGCTGAACTCGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATCGCAGCTTCTG
TCGACCGACAGAAGCTGAACGCAGACAATGATGGTAGGGGCAACACTAATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCAACTCAAAACCTGCCTAA
ACATGCCGTTTCCGACTTCGGGGAGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTGTTGGTACGGCACGGCAACGCCTACACGCTAGATATT
CCATCTAGCATGCGCATCCATCCGACCTTTTACGTCGGGCGGCTGAAGCCATACCGGCAGCACGAGCCACCTAGCTTGGCTGGCCCGAAGCGGATGCCCC
AGCGGGAGCGAACCTCTGCTCCAGCGCGTGAACGCGCTGGGCCAAGCGTGCGACGCGACCTCCCACGTCGACAGAGATGTCCGACGCGGTCTGCGAGGCC
TGAGCGACTTGAGCCCTCAGGATCGCCACCTCCTGCTTCAGAGCGGCGAAGTTCCGGCTCTGATTCTGTTCCACAGCAGCGACCCGCTCCTCGAGCGTCG
GGCCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGAGC
GTATTGTGAACCATAGTATCCCGAAAACGAACCGGCAGCCGGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGATACATGGGAGCCACG
GGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGCTCACCACGCACTGCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAG
CGCCCGAGGTCCCACGATCGTCGCGTTCCTCACGTGCCAAGAACTTGGCACGGAGATCCTTGAGACTCGCAGGTACACGAATCGTCGTGTGCCCGTTTAG
GTCGCGGTCGCTCAAGCGCGCCGCACCCGGAAGACACAACGTGCACTGTTGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGG
AGCTGCTCCAGCCGCCCGCGCGTCGAGAATGTCTCGAAGCGTTCACGGGCATGCTTAACCCGCTCGCGGTAAGCAGCCGGCTTCTTGTTGAAGTTCTCAA
CAAAAGCGTTCCAACTTTGACAAAGTCAGGCGCTCTGCTGCGAGAAGAAGTCTTCTTGCTGGAGAATTATTGGAGCTCGTGGAAGAGCCCGATGTAATAA
TCGCGCCTTTGATTCGTTAACGGATCAAAGTGCTGCTCCTCCGCAACAGTATCGTCATGGATACCGCTACATACGTACAGCGGGATTTCGTTTGGAGGCA
CAGTGTTGCCCATACGGTCTGCGATCTCTGACGCAGACGGCATCCACGGATCGCGCGCTGCTCAGGCAGCGCGCGGAGAGCTTGAAGGCGCCACCTCACG
CGGGGAGCTTCAAGCCCCAGCAGCAGAGAGCAGAGTGTCGCTCTCGCCGCGCGAACGCTTCGAGCTCGAAGCGTCCGAGTCGTCTCCTTCACGAGGGCGT
CTCGACCCGGCATGCGGGTCGAGACTATCGCTGTCGATAGACTCCTTGCGCTTCCTAGAAGAGGCCTCGCCCTCTTCCATCTCCACGTCGTCGTCTTCGA
AGTCAACGGCGTCGTTGACTACAGATGAACCTTCGAGGACAATCTCTGGTTGAGTTGTCCCCGCCGCAGCCTTGGTAGCAAGAGCGTCACGCTTTGCTTT
GAGACGCTCGCGGTACTCGGGGATAGAGAGAGTCTCTATCCCGGCGGAGGACTTCCCCTCTGCTGCAGCGTCGGTCTTCTTCTGAGGCGAGCTCATTGCG
GAATGAGCTCGAGTTTTCTTTCTCCCAACGTGAAGAATTGACGAATGGTCAATTCCCTGATTTACGTGCCGTGACTCGGCGCGTCTAACCTTAAGGGGGG
GGGGTGTAACAGGGTTACAC