Description :
From Genome Similarity Track
Location :
Scaffold_61:80233- 90705
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16957hypothetical protein

Sequence
10472 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAAAAAGTAGGCACAACAAAAAAATAATAAAATGGGCTCATGGAATGGGTATTTTTTGGCTGTAAAGAAAGAATTAACATGTACCGTACCGTAAG
ACGTCGCCTGTGTTTACTTGCAGATGATAATAATGGCAGAATTCAATGAACTATGTGTAATTCATGTAGTAAATCCGCCGTGATTCGTATATAAATCCGC
GGTAAGCTGGACTATGCTGAGACGGGCTCCAAGTCGTGATAGTACGACCTATTTTTTGCCTTTCTTATGAATCTCTTGTGACGCTGCAGTCGTGTGGTGT
GTTCCAGTGTGCCTATTGGTTCGCTTAGTACACAATTTGGTGCATGCCACCCACTCCGCCGGTAATGGTTTTCGGCTTATCTTCGTGATCGACTTTAAGA
TTAAAATGGCATCATGGGCTCTGTATATCCGATAGCAGTGAAATTCAAAGTACGGTATGGTGAACTTAAAGATAAAAATGCACATGAGCAATACTGGCTA
GACCAGCAGCGCTATTGTCGATGCAAATCTGGTCTAGCCGTACTATTATCCGTATATGTACAGCCGTCATAAAAACTAGTCTTATTTGAATAATTATGAG
CACTATCTATAAATTTAATCCGCCTGGACATACAATATATTTGCATATACACAAATAGTATTAATTACATTACGAACAGATCACTAGAAATATGATAGGA
CTGCAAATGATCGAGAAGCTGATCTTCCATTTCTCAATTTCCACAATCGTATAGCTTTGAACATATAGCACTATCTTCGTATAATGATAAATGTCGACTG
CAGACGTCCACGGCCTCGTTGATATTGGCTGCACCTGTGATTGCATAGCTTCCAGCAGTGAGGCTTTCCAAACGTTCAACCGCTATGCCGCCTTGAACTG
TGACCCAATTTGGAACTGAAAAAGGGTTCATCAATGCATCTTCAGATTGTAAGGGTTGTGGTGTCAACTACAAAAAATGTAGGTTCTTTTCTTGTTTTGG
CGTACCGTTTCAAGGTCACGCAAGCCTAGCCCTCAATTTTACAGACGAAGATAATTGGTGTGTCCTCAATATTTATAGCTAAAGTGTATTATGCAATACC
AATGCCAATACCAGTACACGAGCGTTTGCAGCAGAATACCCATCACCATACTCCTCAAATCGAAATGCTTGACGAGGTACCGTATCCGAAAGGAAGCGGG
AAGTTCAAAAGGCAAGTTAGGATCATTCTGCATTTTGCAGCCTCGAACTCACACGCGCTTGGGTAACTTCCTCAAACGCTTCGCGGGTATCTTCCAGCCG
CGATCTCTTCAATATGATCCGATTAAGACTGGCACTCATCGTTTTGACAGCCATTGTCAGTACCACCACCACACAAGCCATCGATTGGACCTTTTGGAAC
GATGACGACGATTCGACTCCTTCACCCGTGTCGTCCGATACGTCGATATCAGAGACCCTGTCTCCAGAAACGCTGTCGAATATGATGGGGTCCGATTACA
TGGACAATGTCAAGTCTGTGATTTACTCTGGAAAGGGGTCAGACTCGGACTCGGACTCTGGTTCGTTGCCTGATGTCGGTTCCTCTTCAGGTTCGGCTTC
CGAGCCGCCTGCTTCTTCAGCATCGTCCTCTGCCTCCTCTCTCGATACGGATGATAACTCTGCATCGAACGCTCTGTCGCTAGCTGGTTCTTTTGGTTTG
GACTTGCCAATTCCTTCAATGGACGAGATCGCGACTCCTTCAACAGCCGTTACCAGCTATAAATCGACCTACCGCAACTGGGTGGGACCTTGGACTCAGT
CCTCGGATGCGGCTTGCTATCGCGAAGCTCACTTCATGAAAAAGTGTCCGAGCAACTATGACCGTAACGAATTAACCAACACGTGCTGGACGGAGTGTCC
GATGGATTATCCCGTGGAATGTGGCATGCAGTGCATCCAACAGAACAATGACTGCGGTCGTGAGAACGCTGCCAAGATTTCTGCCGTTGCCATGTCCGCC
TTCAGTATGGCCACCTTTGGCGTGTTCGGCCAGTTGGCCAAGTACGGAAAGCACGTTAGCTGGGCTGTCAGATGCGCCAACTACATGATGGTCTTTGTGA
GAGCTGTCGTGCGTTTCACCCGCAACCAAATGGTTTTGGAGCCGCAGACATCACAAGCAAAACTTCTACTACTGCTGTACCAGACCAACTATGTCGTTAG
TGATCTTCCAGCTACGATTTACGCGTGCTCGGGCAGAAAAGTTCCGGCTGGTCTCCAGCTAACACGTCGGCTTATCCGCACCGCTCAGTTGGTTCTACAG
CTGGTGATCACCTACGATGATGAAATTATCGAAAGTTGGGAGAAGTTCAAGGCTTTCATGATGAAGGCCAACTTCACAGAAGCCGCAGAACAAATTACGG
AGGGAGAGATCTCAAGTCTGGTAACGGCTATGAAGCAGAACTCCACATGTGGAGACGACCTCAAGACGTTGACCAACCAGGTCTGGATGACGGTGGACGA
GTACAGACAGAAGGATCCCAAGATCAGCGAGTCCGAGCTACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGGTTTCGGTTTCAGCAACGTGGGGGAACCAATGTACACGCTTCATGAATTCGTCT
TCAATACCTAGCAAGACCGACGGTCGTCACACTTTGCTGTTGACGCTCAGAGCAGCTGTACGTGGCGGTCGGGTAACGACTCGGGAGTCTTGATCGAAGG
ATGAATGATTCGTTGCGGAACGATGTCTTGAAGTTGTACAGTTTCTTTTTTCTTTTTGCCCGGATCTGTATGTCATCCCTCTCTAACTCGCAAAGCTGGG
CTTGTGCATTGAAAGCGTCGTGTGAACAGCTATTCAGTGACGCGGCCGGCGCTGGCAAACAGTTTCTGTGATCTCATTGGTGTGTACGTCTCGATTATCG
ATAGGCGAAAAGCGCTACCGTGCTCACCCTAGACCAGAAACTGTGGCCTGAGCACAAAAGATCGACAAAGTGAAACTGTATATAATCTAAACAATTTAAA
CTGTATTAATAAACTATCTATTATTTATATAATAGATAGCTTACAAGTTTAAGGCTTAGATAAACTGCATTGCCTGTTCGGTCGTAGAAAATCGTTTTTC
TATGGGATAGTGATGGTCGAATTGAGATACATGGTGCCCATGAATCGATACAACTCGTGAACTACAGGGGCCATTTACAATATACTTACATGTTAGTCTC
TCCAGTTTTTCTGTACTGCATGCTCTGTTTGTACATGTCATTCCGGTGGTGGAGACTAATCATCCGCCAAAGTTAGGTACATTTCTTTTTTAAATTCAAA
TTAAAATAGTTCATTAAAATTGTTTAACACAGGTAGTATATAGTATGCTTAACATCACCACTGACTATTGTGCATTCCTGTATGCTGCTAGCTTGAGGCG
ATGAATTCAGCTGCTGCACTGGGGACAAAAACATTTAGCGTTATGCTCTGTTACGCGCTTGGCCACATAAGTGCAGCAAGCACAAAATTCCAATTCAGAC
TAAACAGAGCTCGCTCCAGCCCCTATACAGTTAAAATGAAGATTATAATACCGGTCTACATGTATTATATCTTGATTTTTGAAACTCATACCCCACCACC
AAATTCACAATCCCCCCCAAGAGTTAATCAATAAACAGTACCACTGAACAGGCCTCCTCCAGTCGTGTAGATAATGCCACATTTGCGAGGACCAACCTCG
TACAGATTTTTGCTTTTGGTATCGTGCCGTGGACACCTCCACAAGAATTTTAAACCTTCGCACCGCCCAAACGATATCTGTTTGTGCCGAGCAGCGTTCC
TAGGAAGCGGGTGGTACGTGATGAGCTGGTACGTCGCACGATGCTGTGTTGAAGCAGTTCATGTATTCGGTTCAAGACCTCCGTCTTGGTTAGAGGGCTG
TAGTACATGTATTGACTTCAGACAGGACACAAGTCCGACCACCAAGACGAACAACCAGACCCTATTCGATAAATGCTTCCTCCACTCGAGTAGACAAACA
CCAGCCCTTCGCGCGAGTCGCGAGTTTACTGGGCACAGATTTTCGGCGGAAGTATCCTCCTCATGGCCTCCTGCCTCGACAATGTTGCCAAAGATGGGTT
GAATTACCAACGTGGCGATTAGCAAATCTCATCAGTCAAAAGGAGATCAGTAAAAAAAAAAGAGAGCAAAATAAAATGGGCTAGTTGGAATGAGTGACTC
TTATTACTCATTTAGTAAATGATACTATTATGGAGCTTCGATTCGCTACATATATTCATGTAGTAAGCCCTCAGCTTCTATCTGAACATATATATTCGAG
TATGATTGGACTTGCAGAGGTTGCTTTCATTTCGTGGGGTACGAGCTCTATACAATCAGTACGATATCCATATCGCATATCGTGGAAGATCTAAGAAAAC
GAAAGTACGGCTGCAATGGCAGTGCCGTCAACCGTCTATTGCGATATCGCTTGAGATGTTACCCATTTTGCGACTGAAAATGAGCTAAAACATCAAATCC
TACGATTGTGAAGGGAAGTGTCAACTACAAAAAGTGCTGATATGGTACACGTCAGCCAAAAAATGAACCCAGTCAAACTTTGAGAAAGCACGCTGGCAAA
CCACCCTCGTTTTTACAGATACATGCCGTAATTTTGATGTATTTAGCACAAATGCAAAAAATGAAAGCACTGTAACGGCACTTCGTGTACATGCTTGCAG
CATAATACCCATCACCATTCTTCCTCAAATCGTACTCCTCAACGAGGGAACGAGACCTCGACCGGAACCGGGAGGTCAACAGGTACGATAGGATCATTCT
GCATTTTGCAACCTCGGACTCACACGCGCTTGAGCAACTTCATCAAACGCTTTCGCGACCATTTCGATATGATCCGGTCAAGACTATTATTCTTGTTGGC
TGCTATTGCAACCACCAGCACACAAGCCATCGATTGGACCTTTTGGAACAATGACGACGATTCGACCCCTTCACCCGCGTCGTCCGATACGTCGATATCA
GAGACCCTGTCTCCAGAAACACTCAAAAGTATGATGGGGTCGGATTATCTGGACCGTGTCAAGTCTTTGATTAACTCTGGAAAGGGGTCTGATGTCGGTT
CCTCGTCAGGCTCAGCTTCAGAGCCGCCTGCTTCCATAATTTCGTCATCTGCCTCTTCGGACGATGACTCTGCATCTACTGCTTTGTCACTGTCGGGATC
CTCTACTTTGGACTTGCCAATTCCTTCAATGGACGAGATCGCGACTCCTTCNNNNNNNNNNNNNNNNNNNNN