Description :
From Genome Similarity Track
Location :
contig_100:80231- 87147
Transcript NameFunction/comments
g11025.t1hypothetical protein

Sequence
6916 bases(100 bases per row)
GCGGAAAACCGCTATGTGTTTGTTGATTAGTCGTCGTTGCTTCTGCATCTGTTGGAGCGTTGGCTCAGTGTCTTCTGGATAACTCAGCTGGGGTTTTCAT
GATCGGGTGTGGGTGTTCCTGCTCAGTGTGTTTCCAGTCTCCTTCTGAGGGAGTGGTCTGCTATCTAGTGGTCTCGCTGTGTTGGTTGATGTTGGTGTTG
AGCATTCTACAATTCTCCCCTGTTGATCAGAACGACGATTGTTGTTAGATCCAACCGTGTGCCACTCATACTTACCTTTGTTGTGTGTTTGGTGAGTTGC
CGTTGTACTGGGTTTTTGCTGGTTCTGGTTGGTTGTTGGTTGATTCATGGGCGTTGTGATTGCTGAAGATCCGTCGTTGTTGATACCGTTCCTTGCTCTC
TGGTTCGTTTTCTTCGTCAACCCAGTACCGTCATCTCCTCAAAACTGGTAATTGTTCGTGGTTGTTTGGCAGTTCTGCAATGTTTTCGGCTGTGACTTGT
AAGCAGTGTTCTGGTACCAGTAGTCATCTTGAGCGTTGCATCTGTTGCGTGTGTGTCCGATTGCCCGCATTGGAAGCATGGTGGTGCTGGTTTGACATTC
ACATGGTGGATCAAAATCTTGGTCCCGTTCCAGTTAAGGAATCTCTGGCTTACTAGGAATGGCGGGCATAGCGGGCTTCTGAAGTAGACGTCCCAAGTGT
CCGTTTGTCTCTCATAAGATCCTGCTGATGGTTTTGCCAAGTCGTGTACTTGCCCTTGAAGTTCTGCTGTAGATATGCGTCAAGGGCTGCTTCGTCCATG
AACCTTGACACGTTAAGTAGTCGAACATGGTACCTGTCTCGGGATTTCTCGTCCCGTACTCCATCTGCTCCCATTTGTCTGGCCCATAGACTGGTGGAGC
TATGACCTATAGTGGTAGTTGGTTCCCCGGTTCTCATTTTCATTTCGCAGGGCGAAGTTCTTGTGGCGGAATGGTAGAGACTTGAATTCTTTCCCCCACA
CGCTGCTTGCTCTCGTGTCCAGAAAATCAAATGGATCGCATGCTGGTTACGGTCGTAACAGACTTGTTTTGCGCTTTTCAGGAATGCTACGAGTCGCTCC
TCTGGGTGTTCACTTCTGCGTTTCCCTAGTAGGATCATACCTACTAGTCTTTCTCTCGTTTGGAAGTCAGGGTACACTGGGAAATCTACCGGTAGATGAA
TGGCTAGTCTCCTTCCACTTGGGCTTGGATTGTTCTGGATCATCCGAAGAGCATACGCGCTTGAGGAATGATGGCAAGTGGGCACAGAGAATGGTCCCCT
CCAGCAGTCTCTGATGATGGTTTCTTCTTTTTCTGTTGGCTTGCGGATTTTGCTAGGGAATCCGTAAGGAGTTTCACAAATTTGGCGATATACAGGAATT
TCAGATGCTGGAAATGCAGTGGTCATGAATCGGTACGACGAGCTTTCATCGCCCGTCATGTCGACGTCTGTGTCCGGTTCCTTCTGGGGAGCTAGTTGGT
CATGTTGCTGGGCCCAGGCGTTGACTACTGGGGCTGTGGATGCCTTGGAGGTTGCGACTCTGTGGTCAACTATTTCAGTCAGCATGCGACGTGTTTTACA
GTGATCGCGTGATATCATACAGGCGCGCCCTCCATTTTCTCGCGTCTGGTCGACCAATGGCCGCGTCCACCAAGAACAAGTTCAGTAGTTGTTCTTTTTC
ATCGTCAGTCAGAGTCGGGTATCTGCGTTGTTGTTCGTTAACGTCAGGTCTGGGTGCGTTTGAAGACTGTAGTGAACATGTTCTCCATATATTCCAGCGC
ACTGACGGTGTCTTTTGTTTCTTCACCCCTTGCCTGCTAGTTCTCCGTGCAGGTAGAGATACATCTCCGCGAACGTTAAGGCTCCTCTTCAATCTCTTCG
TACGTTGGCTGATCATGGTGCTTCATGTCCTCATCCTCTTGGTTGTCTTGCTTAGTTTCTTCTTCTTCCAGCACCTCAGGCATTTCCTTGTCTTCCGTTG
TTTCTCCACTCTCCTTCCAGCGGCGTTTCGGCGTGCTTTCCATAACCAGTTCTTCTTCTCTTTCGGTCGGATCTTGGTGACGTTTGACGCCTGCTGTCTG
CTCTCCCTTGCCTTCCTCTGGCGGAGGTGATGGCGTGCAGACGTCGATCACCTCCCCTGGATTGTCTGGAGGTTGGTCCGTGGCCTGCATCCTGCTTGAC
GGTGATTGTGCGATCTTCCGTCCAGCTTGAGCAGAGCCCCTATACTTTAATCAAGTGATCCCCCCTGCGATCTTTGACCTTGGCTTTTCGTGCGGTTAAC
TCCCAGTTACCGCTGCTGTTTCTTTTGCGACCTTTCCCCTTCGACGCAAATATGGAAGTGTTCATGGGCTTTTAGAGAAAATGTCTTCGTGTGATGGCGT
GATCCTAGGAAAGTGTATCCGTGGGATTGCGTGAGCCAAGGAGTTTTATTTTAAATGAACTGGTTACGGGTATCCAAAGCATTCCCTGACTCACCACTTT
GAAACTAGACGAGAAAGTTCGCCTCCAACAATAACAATGGGAAGCAGCGCCCCACCCCCACCGCCGAACGTTCACACGCTAAGCGACGATGTGATCAGAA
ACGTGATGTCATCGCACCTCTGGCCCAAACCTGGAGTCGGGCGTGACGGAGACGACGAAGCCTGGAGCTCAAGGACGACAAACTACGCGAGTTCGAGACC
ACAGTATTTCCAACAGCTACTTAACAGCGTCACCCTCCAGGCACCTGCTGCAGCTCCTATCAAGCACAAAGGCACGCTGGACCCCTCACAGCCTGTCGGC
ATAGAGAACCAATCCGCTGATAAAGTACGGGTCACAGAGGAAAATGCTGATGCGGAGCTCCGCCGGCAGCGCCGTCGGACGAGCATGCAGAGGTACCGGA
AAAAGCTCCAGGACCATGCAATCGCTCTAGAGCGTGACGTCGGAGAGCTACGAGAAGAAATCCAAAAGCTCCAGCTCCAGTGCCAGGCTCTCTCTTCTGG
TGTCCCCACCGGAACGACTGCCTTGGCGGTGGTGGCAGAATACTTTCGCCTGTTCCGATACGGCTTGAAAGGGTCCGCCCCAACGAACGACCCTGGCAGC
AGCACACACGTGGCCCCGGACACGTTTGTTTCTAGCGTGCAACGCGATTTCCTCCATGCAGCGGTATCACCGGATGTGGTGGGCGAGACGGGATTCGGCG
TCGAGAGGCTCATTGAGGACTACCGGCGTCTCGCTCTCTACCTGCCAGACTCGGACACCCAACTCGTGCGCCTCGATACCGGTCCTGGAGACTCGTTAAC
CGCCATCGCAGCAGTCGCAATCGTCGTCACGGCGAAGATGCTGCATTTTGCATTTCCTTACCTCGTCCGCGATGGAAATCGAGGTCAGTGGTCAAGCTTG
CTGCCACGTTGCTCGGCCAGCGGTTCATGCTGCGTGGCTCGATCCAGTTCAAGTGGGACAGTGTGACAAGCCGCGTGAAGCTCGTGCAGACCAGAGCAGG
CATTTTGACTCCGATTCTGCGATTACTGGGCGACTTGGAGACCATCTCCCGCGTGTTCGACAACGCGCTCATTACTCCATAGTGTAAGCTAACACACTAT
GCCAGTCCCAAATGCTTCATAGGTCGCATAGCGTTCTTTTTATCCTTAACGTGTATACACCCGGCCTACAGATTCATGAACTGCGAGCGGAATCTCATGA
GAAATCGTTGATGACGATCCAAAATATTTGAGCGGGGCATCAAGGTTCGCCGTTACCTTTTGGCCATATAGCCCCCCTTGGTTTACCTCGCTCAAAGTTA
TATTTTCATTAGCCTACTACAATTGTGCCCTTATTTATACGTTCATTAGCCGACTACAGTTGTGCCCTCCGGTAGTATCAATTTGATTGCCTGGGCCACG
AGCGCGCTCTTGCTACAGTACATGCATTAGCTCGTGGCGATTCAGTGGACTGCATCATGTGCTAACCTCGTAAACATCGCGTTTTTGGATACACGGGCAT
TGCAACGCACCACATTTGTTCGTAAACACGTTGCTGCCCCCGCCGATAGAGTTTTCAACCTGTACATGCACTTCGTTTTGCTCCACAGAGCCGCCGATAT
TATCATACATGTACTTGAGTCCAACAGCTCACAATTTGAACTTCGCTATACAAATTAAACTTAATTAAATCAAGTGGTGTATTCGCTAGTTGACGAATAG
AGAGTTGGGTTTGACATGCAAGCCCAACAACCTAAAGACGGTCGGGCCACCTCAACTTGAACTTCTCAAGGTATGTACGATGCAACATCTTGCCTGCTAA
GGAGCTACCCAATCTTGGAGACAGCTTCAGGGTCCTTCCTGGCAAGCACCCACTTGCTCAACAGCGAAGCCTGCATGTCTGTGGCAATCTTCTCCGTCAC
TGGGTCTTTCTTCGCCGCAACGAGCATTTTGGACAGCGCGTCGTCACCGAAGTTCCTTCTGAACGTGTCGATCATCGATACCTGGTTCTTTCGGGGCAAT
CCCGAGTTCAGATCGTCCATGTACTTGACCCACGCGTTCAAGTTCGGGTTCTTAAAAACCTTCTCTGCTCCAACGTTCAGGTTCAGTGTCTGAAGGCGTC
GTCTGCAGAAAGCCCCATATTCTTCCAGCCCTCCAACTGCTTAGTTTGCAATGCCGTCGCGGCTTCCTTCGTTTTAGGCATCTTCAGTCCAGCCTCGAGC
ATCTTCGACAGAACGTCGTCGCCGTATCGACTCGTCAACGAAGTAACCATAGCTGCTTCTGGGTGTCTCGGATTGATGAGACGGACGTACGCGACCAAAC
ATTGACGTCTGAGTTGTCGAACAGCTTCGTACCAGCCTTGTCCAATTTCAACTTGGAGAACATGTACTCCGACGACTTCTTTCTGTCGGCATATTTCAGG
AGATCCTTAAGCGTGACCTTCTTGGAGAATACATTCTTGATCGCCTCGATCCCTGGGATGGATTTAAAGCTAATCGCTCTCTCTTCGTCGTCCTCGCCCG
TGACGCTGTCAGCTCTCAAAAACCGCTTGGAAGTCAAGGTGTTTTGGGCCGCATTGATCCGCGACGTGACCAGCTTCGAGTCTGCCACTTCGTGGAGGCA
GTGACACCTGTAGCGACGAAAGCAGCAGTAGCTAGCAGTACAATGTACTGGAGTCTCATGACTGACCCTGACAGACGTTCTTTGAATCTCAGCAGTGGCG
AGCAAGTTGGGAAGTGGGAAAAATTGATGGGCTACGATTTCTGCGGACATGGAGACGTCGGGAGGTACGGATACATACGTGTAACGCACTCTCTACAGTG
AATCGTCACGACAAATTGTCGGACAACCGTGGCGGTGTAGCTTGCGGTAACCAGTGGCCACCATCAACATGTACCGTTTTCTGGCCAACCGATCGTACTC
TTAATCACCATCCCGTGTTTGGCAAATAATAGAGAAGCGTTGCGAGTGCTGCATTTATCCGGGTGCTGCATGCATATGACTTTTGCGGTATTGGTGCTCG
ATACGATTACGATGTCTGCAAGTTTATGCGGCATGTAGATATTGTGCGTTGCTGGGTCGTCTGCGGCTTACTGGGAATGCATTTTTGTTTGCTGGTGGTG
GTGCAATGAAGGCCGAGTCTTTGTCGAGAATAGGTGATTCTTTTGTTTTGATACCAGTTTGGTAGATCAGTTGTCGCTGTCGCAAATACGAGGTTACCGT
CTCCGATAAGCCGATAGTTTCACAAGAAGAATTGCGCTTAGGTATCGCCACTCAACACAGAAATGATGGATGCTACAGTCTGCTGGATCCTGAAGTCCCG
CGGTACCTCGACATTGACAGCGCTTTTGAAGCACTGTCGATTCTCATTCACCAGACTCATGACAGCATACTTGCAAGCCAGTGTCTGCGTGGCTAGATCG
CACAGTGTATCGTAAATTCCACTTGCTCCTCTGTGGTACCACCAGCGTTCTTCTCGCGACTGTTTAGACGTAGCCGTTCCTCCTATCCTTGCTCTCTTGA
TCGCAGGGTGCAAGCTGCAGTAGCCAAGTAATGCCCACAATGTTCGGCATCGCAGACACTAAACCCCTGGGAGCACCAGCAAGTACTCTTCCACCGCGTC
GCACATTATTGTGTATTTCTTCAGGCAACACGGCGCCATCGGCTGTCGCTCTATTCACCGCGGCCACAGCCGCCGTCATGTCGGCCTCCTCCTTCTCGAG
ACCCGCAGAATTTGGGCACCAAAGCAATTCGATCACAATACACTTTACCATTGCCAACCACGCCGCCCATATATCCAGCTTCATTCTATTCATATCAGGT
GTTCCTTATTGATGCACATGACTGTACTTTGACTAATAGATGTCCCCAACAATTTACCTCGCACAGGTAGCATGGAATTTGAAACTGGCCGGGATGGGAT
GTACTAAGATAGATGCAACTTGGACAGGAAATGCTGTGCTGCGGGAAGCTTTCTGCACATGCAAGCAACACATTCAGAGTAACTTAGTACTTTTGCATCT
ACCGGTATAGTACACTGTGCAAAGTTGCCGGGACATCTGTACGTGTAGTAAAGGAGCATCCTTCAGGCGATCGCCTAGGTTGATAGGGGGGGGGGGGTAA
ATAGAAAGCAATGTACAGTAGTATTTTTATACTATTAACACTAAATGACTGAGAACCACATACCGGAAATGTCCCTTATTCGGAATGCGGTCAAAAGTTG
ACTGCGAATAATCGTTCGATGCTTCTGCAATTTGGTCATCGTATCGACACTCACTAAACATTTAAAATGGTGGAGCCCCTGTCCTCAGAATCGCTCTGAC
GTGCAAGTTATTGGAGCACAAATGTCGGTGCCGGCGCGTCCAGGAGGCATTTTGGCCGCAGCTTCTAGTGTGAGCCCGGCTTGATTGCAGAGCTTTTGCC
ATCATAACGCGTACCA