Description :
From Genome Similarity Track
Location :
Scaffold_31:80220- 81411
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_07771Hypothetical protein

Sequence
1191 bases(100 bases per row)
GCACGTTGGTCCAAGGAAGGCTCTTGAGCGGCCGCGCGACGCGGCAGTCCGCGAGCAGCCCGCCGCCACCCAAGCGAGCGCGGCCCAATGTCGTGGCAGC
ACCGACGCTGCCCTCGACGTCCATCGACAACCCGATCGTGCTCTCCGACTCATCCGACGGCGACGACGCCGCAGAAGCCAAGCCGTTAGCACCGGCTTCG
GGCGCATTCTTGGTGCGCGGCAAGGCCGTGCGGTCGCTCTTTGGTGTCGGAACCATTCGCCACGTTGCGATCCACCCTGAGCATAGCATCTTCACCGTGC
GCTTGCCTGGCGGCGGCGTCGGGTACTTTAACCGGCAAAGCTTGCACTGCGTCGACGAGGAGCCGTATGCGACGTACCTCAAGCGGCGCACCAAGGTACA
TACTTGTACCTGTATCCAAGGACGGTATCGATCCAGGACATGCGTACGTAGGGTCAAGTCGTTTTGACGTACGGCGACGTAGGTCGGCTCGACGACGGCC
GGCTCTTTAACGACTCGATCTTGGAGTTTTACCTGAGGTGAACACCGAGCCTCGACGCGTGCAACGCAAATAACGATGACATATTAGCTATCTCTACGAC
ACGCTGCCACTGCAGCACGCCACGTATATCTGCAGCACGTTTCTCTTTGGAACGTTCCAGCAAGCGCGCAAGAATGGACTAGACGCGGCGCACGCGGCCG
TGAAGCGATGGACCAAGGCCATCGACCTCTTCGAGACCAAGTATCTCGTCGTGCCCATCAACGAGACGTACGTCCCTCCATGAACACAAGCGAGAGTATG
ATGATGATGATGTATGGGGTGTAGAGGGCACTGGAGCGTCGCGATTGTCTGCAATTTGAACCGGTTTGTCCAAGCCAATGTCTGCAAGTGCAGTCTCTTC
CGTCCCGAAGCGATTTGCACACCGACGATCTGCAATATGTGCCACCGCCCGCGCGAGATCGAGCAAGGAATCAACGACAACGTGTGCATCGTGATGCTGG
ATTCGCTCAAGTGCCATCGGACGGTGCGCATCACAAAGTTCCTCCGCGAGTACGACGACGCACATACCGTGTAGACATGCGTGTCTCATATTGCGAACTA
GGTATCTGCAACTCGAGTGGGATACGACCCATCGCAGCGTGCATGGTCCGCTGCTTCTCAACCAGAAAGTGCTGCCGGCCGTCGTCCCGCC