Description :
From Genome Similarity Track
Location :
scaffold_63:80201- 84259
Transcript NameFunction/comments
g2513.t1hypothetical protein
g2514.t1hypothetical protein

Sequence
4058 bases(100 bases per row)
TTCCACCGGGCGTATACGGTCGGGGCCTTTTTCGAGTTCTTCTCTCCGATCTTGGAGGTGTCACACCGACGTTGCGCTCAGATACTGTCGAGTCAGCGAG
GTCAGATATAGAGAGGTCACGCTCAAGTTCACCAGCAATATCATCACTTAGTGATAAGGCACTTTGATCCAGATTACCGCTAGTGATACTAAACCACGTG
TCATCACTTTCAACACTCGAGTTTTCATCAGAGTCGCCAGCGTCATCAGGAGACGCACCTATTACCGATGGTGGGGCACTGTCACTTTCGTTTAGCATGA
ATTTCTTCAACGCCGACGTGCTGAGAAAACTCCCCCTTCTCATAGTATCGTATCTGTCGTCTGCATTCTGCAGGTGCACGTCAGGATTCCCATATGCATC
CTCAGGCGAGAAGAAACCCCCACCTGAGTATTTCCGTGTCTTTTTCGGCGCCTCGGCATTCGCCAAACTAAATCTCTCAGCCAACGCCACTAACTGGAGA
TACTTTTCCAGTGACAAATTGAATGTTAAGGCCGGCAGGTCAGCGTGTACGTAAAACCTTGTCAATGTAGCGTCAAGCGGCAAAATCGACATGCGAACGG
TGACGTTGATATTGAAGCGCTCGACAAGCTCGTATTCTTGCTCCTCGTCATAGATATCTGCAAGATATGGCGGAAAGGAAACTGACGGATAGTTCATACC
GTTGTTTCCAGTCGCATCGTCTTGAACCCGACTGGTCTTTCCATAAGGAATCAACAACACGTGAATGTTTGCGATCGAGAGGCTGAATTTATCGTAAAAC
TCCTCCTTCCAGCGAATAGCTCCCTCACCTTTCTCCGCTTCATCATATAGTTGTTGCACGAAAGACGTATTCGGATTCACACCGCGAAAGTGAGACGGGC
TCATTAATGCGAGAGACCCCGGCGCCGACCTACCCGATGACGGGCCACCAGTTGAGCTCATACCCATTCGTTCGTTATCCATTTGACTAAGACGGTCAGT
TCGAAAATTGATTCGTCCTAAATCAACCACGAGGCGAGCACAGTTGTAGTCTGTATCGCTATCCGGAATAATGATGACTGGTGCTTGAATACGGAGATCC
ACGGCAAGTGCAATTCTATTCTCCATCACGTAATCGAGTTTAGCATCGGTTCGAGCCTTCAAATTGACGATATCATTAAATGACGCGACCTCCAGTTCTT
CCCACAAACCCAAACTCGTAGGAGTGTCCATAAACTTCGCCAACCGCCCCCAGCACCGTGCTGTTGGCGAAAACACGATTTCAAGTGGCTCCATGTGAAC
AAACAAAGAGGCATCTGCGCCAGAATTCGCAGGGTTCATCTCAAAGCTCATCAGGAACACAACGCCAGATAATTTGCTTACGTTGATATCATCCCCCTCG
CTAGTAGGACGAATAGTTTGCTTTCTACTGAGAAGCCGCGAAAACGCCGAGCTTTCGGCGCTTTCATCAAATGCCTCAATAGACTGCAAGGACACATCCA
CAACCACTGTTTCATCCCTCGCCACTGCAGCCATTTGTAGTTGAGAAAAAGTACCAAGCAAAAACTCAGTGGGGGCATACTTTCGCCCGTAGCTTGGGTC
GTTTCGGAGCAGTGTTCTGTTTGTTTCAGGGTCACTTGCTAGCGTTAGAGATCCACGCTGCAGCGTCACAGTCACTCGATAAAGTTCGCTGAGCTCCATC
TGGGACTCACTATCAGATACGTCATCTTGCCCACGCATGTCTCGATGTTTATGCGTACGCTTCTTTGAGCGCCGGGGCTCTTCTAGTATGTTGAACAGTT
CTCGAAGCTCCACTTCAGGAATAATCCGATGAGGGTTTTTTCCAGATTCTCCGTCTGTAGTAGGCGTAGCCAACTTCGACGTCCAGCCAAACATCCAAGC
GCCCCATGATCGATAGCGAATCTCTGCTGGTACACTAGACTCTGTGAATTCTGTGTCTGCTGATTCTGTATCAGAAAATGCTTGTGATTTGTGTGTCGGA
GGCGTCGGCAATCTGCGTCGAACACGAGTAGCGCGCGAAGCTTGAAACTTTCGAGCTTCAAGATCAGCTAGGTAGCGAAAAAGTAAAACGTCTTCGACAC
TTCGACGTCGTTCAATTTCTTCTAACCCAAAATCAAGCTCAAGAGACGAAAGTTTCGGTAGGTTCGTATAGTCAAGACGTGAAGGACCCACCCTCCCCTG
GTCACCCAAGGTATCCTTACTGCCATCACCACGATCATCATCGTCATCATCATCATCATCATTGTCTTCACTGTCAGAAATAACATAATCCACATCTGCA
AGCTCCAGTAGTTGGCGTGACTTCAACTGCCACAAGCTAACGTAGCGTTTGCGGTCCACGCGTCGATCTTTCATAAAGCCCCACGTCCACTGCTGCTTTT
TCATTTTCAAATCTTCCATAACCGAAGTGATGGCATATTTCCACCATTCTACGGGTTCATCAAATACACTTGCCCGTGGCCTGAACTTGCGATACCGCCT
GTACTTTGTGTAGTGGTCTGGGATCTGCAGGGCCGACGTCAGGTACAGCATATCACAGTACTGCGACTCCTCCAATCGAAACGCCACCTCTGAAACATTC
ACATCGACCTCAAACTTTGGCACATTCGCATCAAATACGTCACGGTTCACAATTAGCCTCGCGCTCGCATCAATCGGCTTCAGCAAAAAGTGATGTTGCT
GTTGCGACGGGTACAGCTGCATGTGGTGGAAGTGTCTATCATCAAACCGCTTTGGAATCGAGCGGCTGAACGCGCTGGAAAACTCCTCCGTCGAGCAGGT
TTCAAAGTCGATTTGGCGGTTGCGCTGTAGCTGGCAGTCTGGGTTGCAGTACACACTCAAATGATTAAGCTCCACAATCTTGAAAATGCGCGGCTCGTTG
CTTTTCGAAGTATCAACGTACGACGGCTGCCAATTTGAGTTGGTTGACTGTACGTGCACCGACTCGATAGTCAGACCCATAGCAAACGGATGATCCCCCG
TAGTATGGTCCTCCACACGGATGTGAATCCGCCGGATGTGTAGCTCCAAGTTGTCGATGATTTTGTTGATCAATCTGGCTGCAAAGCCATCCTCGTTGCT
GGATGCACCTGCTCCGTCTTCTGTCTCCTCTTGGCGTTTGGCCTGGGTGTAGAGCTCCTCCAGCAGCTTCTTCTTGATTGTAAACTCATCCATTTCCCGC
ATAACGGCGTCGATATCTTCCTCCGTGCGCAGTAGCAGGTACACATCGTCCACCGTGGCCACCACCGAGTCGGATTGAAGACGATTCCAAGGGATCTTTA
GCTCCAGGGACCCCACAACGCCGCGCACGAGCTTAACAGCCGGCAGGTCTGCCACCACCTCTGGCTTGACCTCCAGCTCCGTGAGCACGACGTAGCCCGA
CCACACCGCTACATTAATCTTGTCACTACTGAAGCACTTGGGCTCGATGTAGCTGCCCAGCGCGCTGGTCAGCAGCCCTGTCACCAGGGTCTCGAACATG
GCGTCGGCGCCAGTGCGGAATCGGCTCGCCCCACAATGTCAAGAGTGTTTGTGATGGACTGGATGTGGTGCACTATTATACACTGTGTAAATCGGTGCTA
GGATGTGTAGTTTTGTGCCCGTTCACTTCAAGCAAAGGATCGAGGTTTTGGGGTTTAAAGGATTCTAGTTGTGTGGCGCTAGCACAAGCTGGCGAGCCTG
GAAGAGGAGGGGGAGAAACCCCATAGTGTTAGGACTGACGGACGTCCCTTAGAGTATGGAGAGCGTGGACGCGGCGCTGCGCTACCTGCAACGGCAGTTC
GCGAGTGTGGCTAGCGACGAGGCGCAATGGAACCAGGAGCGCCAGAAGCTGCAGGCGCACGTGCGCGATCTCGAAGACCAGCGGAGCGAGCAGGAGCAGG
CGTATAAGGACGCCATGTTGCGCGTCAAGATGCTCGAGTTCGCGTTGCGGCAGGAGCGTGGGCGCTATCTGGCGTCTCCCGCTGCAGTCTCCAGCACGGG
GGGTGCCAACACCAAGCCGCGCTCCGAAAGTGCTGAGGTCTCACGTGGCGTGACGGTC