Description :
From Genome Similarity Track
Location :
Scaffold_655:8020- 12210
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_655-abinit-gene-0.25Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_655-fgenesh-gene-0.1Calcium-dependent protein kinase

Sequence
4190 bases(100 bases per row)
AAACCCGTCTCGCACCACAGCTCTTTCGTGAGCCGCTCGAGCGTCGCCAAGATGCGGCCGGCTTCTTCGCGGTCCCAAAGTACCTTTTTGCGGAGCCGAA
ACTTCTTTTGGCCATAGTTTTTCGCAATCTTCTTGCCGTCGATCGTGCCGGCACAGAGTTTCTTGGACACGCGCATCGGATCACACTGAAGTTGGACAGC
GAGGTAACCTCGCAGGCGGATACCAGTGTAAATCGGCAAGTACCCTTCCTCGAAGGCCTCAATCAGCAGCCGCGCGAGCCGTTCCTCTGTCGGTGTCCAC
TGGCCCTTACGAAGGAAATCCGAACTGCCCTTGCGCTTCGACGTGACAGAAAGCTGTTTGCCCAGGTCAATACCGTCGACGACTACGCGAGACCCTCCTT
GGGAGGCACTGGGCACATCGGCGATCCGTTTGCGTTTCCCTCCCCACATGGGGGAAAGCGCGACCCCCGACGAGAGGATCGCCGCATCCTTTTCCGGGAT
CTGGTACTTGGCGTACTCCTCTGGGTACTCCCGCACGGGTGTGATAGTTTCTTCGTAGAGAGGCTTGTATTTGGTATTTGAGGAAGGCGGAGAGGCAAAG
CCGCGGCCGTGGCCGCCATCGCTCCCTTCGTCGTCTTCGTCGCTTGCGCCGTACGCGTCCAGGTCTTCCGCGGCCTCGTCACATTCCATCTCGACGTCTT
CCAGAACCGCCAGTTCCTCGTGTTTCACGTTGGGTGCTTCTTCCTCGCCTGTACGGGGGACACTAGCGGCGTCCTCGCTCTCGGGCTCACGCTCCGCCGG
CGGCGGCGGCGCGTCGGCCTTGATCTGCTTCGTCTCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTGAGGGTTTCCCTTGAGGCGCGGAGGGGGGAAATGGTTGTTTCCCTTTCTTTTCTGGGGGTAACTTGCCGCAGAAA
AAAGGGGGGAGGAGAACGACGGCGGGTCATCCCTCCTGTCGCTAATAAAACACCCATGAGGTGACTTGGTTTTACTATGGGAAGGGAGGGAAATATCGAA
CTGGGAGGTTGGTCGTCTCGGTCACTTGCACCTCTAATCCGTTATTTCTCATTGGCCGTAAACTTCTGGCGGTGCAATATCTATATGTCAAGAAGGTTGC
AATTACTTCATAAACGCATACCTTGTCTACGCCGATTATGGTGGGGAAACTTGTGGTGACACAGCAAGTTGCCGCCACCATCACTCTAAACTGATCATCA
CTCCCGCGGGAAGCAACCAAAGTTTGCACGTTTCTTTCTTCTTCCATGCGCGCCCTTTTGCGTTGGTGAGAAATCTCCCAACACCTCTCACGCCCCCGCA
TTCGCCGAGCGGATTCATGATACTGCCGGACGAGAGGACTCGCTAGTGACTCGTGGACGACACGCCATGCGTGCGACAACGAGACGAACTCCAGTGCGTG
TTGAATCCCACTGGCTCGCCTTTTGGCGATATCTTCCAGGGATGGACCATCACGGCGCTCTATTGAGGTGCTGTAAATGGGTGAATGGGTGAATGGGTGA
CTGCTCCAAGTTTAAACTCGTTGGGTGTTTGCTAACTGGGTGGTACCGACGAGCGGGAACAACCTGAACAGCTCCGAGGTGAACATGATGAGTGAGACGA
CCACCAAGCCGACCGACGCCACGGGCAGCGCCGCGGCCGACGCTCCAGCTGCCAATGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGAGCCAGCCGAAAATGACAATGATGCGGCGTCCGCCGTGCGCGCCGCGAGCAGC
TCCACCGGCTCGCGCAAGCGCGTGTTCACGTTCCAGAAGCGCTGGCTGCACACGCTGCCCATCATGGAAAAGGTGCTTCCAGACAGCGCATTGGATGCCG
CTAGCGTCGTGGCGTTGCGCGCCGCGAATCTGCTGGGTGAGGACGGCAAGCCCGTCGACGACGGCGGCGCGCGCGACGTGGTCGTGTGCATGCTCTGCGA
TGACCCGAGCGCGAGCCGCGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCATTGAGAACCACTTGATGAGCAAGCACCCCGAGTTCATGTTGCTGCTCAAGCAAAAGCGCGAGACGGAAGGCGACCTCGCCGTGCAAATCT
TTCTGCAGAACATGCGCGAGGGTCGCTGCAACGTGCGCCATGAGATCAGCGCCGGGCTGTACAGTCACATGCAATCGGCGCCGAGCGCTGAGCTAGCCCA
CAAAAAGCGCGCGTTTGCGCACGACGAGTTCATGATGCCGACGGCAACGACCACCCCGGCAGTCTCGCTGTCCAAGCAATCTCAGCCGTCGCTCAGCGAC
GAGGCCGCATCCGAGACGGCATTGGAGGCTGAGGCCCGACGTAAGCGTCTCAAGACCAACGGCAACGCAGATGCGACAGCAACCACGTCTGCAGACGCTG
ATGGCACNNNNNNNNNNGATGGCACCGCCGATCTGCTGGGCGTGTCGCTCTTGTCGTACCACGGGCCGGCGGCCTTTTCCCAGTGGAAGAATCTCATGGT
CAACAAAATGGTACGACGTGGAGGTTTCCATCCGATCTGTAGACGCAGCCAACTGACTGGTCGGTGCTTCTTGTGTCTGTAGATTGTTGTGACGGGTGGA
GAGATGCCGGCGATCGCACGAGTGGCCACCAACCTCTGGCTCGTCGGTGCCAATGTACTCGTGACGTTTGCGTACGTGAATGTATCCATTCCCCACCACC
CATGGGTCTCTCAAGTGAACGCTCTGCCAACACAGGGAGCAAGCCCCGATGGAGTCGTTCGCGGCCAGCTACCTCACGCAATTCCACGCGGCCGGCAGCA
TGGAGCCGCCGCGCGGCATCATGCTGCCACTCTATTGCTCGCTACGGTCGCGGCCCGAGATTGAAGAGTGGAGTCGGTCGATCGCGTCCAAGTTTGGTCA
AGTGGATTTCCTGCTCAACTTTGTCCACAACGATGTGTCCCGTGAGAACCCCGTCTCAGTCAATGCGTACGTTCTTGTCGGCCGTGGGGTCGGATTCGAA
CTGCAGCCTGTAGTAAGCCTGTTTGTCTCGTGTCTGGTTGATTGACATAGGAATCGGTGCAGAGAACTCTGTGAAGTCTTCAGTGGCGCGTGCATGCAGC
GCACCGGCCGAAGCGCGATCATTAATATGGCCTGCGAGGCGGAGTGTGGGTACGTCCTGCCGCATACCATGCTTCACTCCTGTCAGAATACTGACTGTAT
TCATAAATGCAGGCAAGAGAGTGACGATACGTGTGCGGCCGTCGAGGCCCTGACCAAGTCCATGTCCCTGCAGCTGCGGGCGCTCAACGTCCAAGTCAAT
GCGCTCGTTCTCCAGAAGCCCGACACGGTGCCTATCGCCGCGGGGGATGAGGACATTGAACTCATTCACTTGATTCTCTTTCTTCTCTCTCCGGCGAGCA
CGTGCGTCAGCGGCAGTGTGCTTTGCCACCGAAAATCAGTCCCGGTTTCAGCCGCTCGCGCGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAACGCCACCACGACCACCAACGCCGTTGAAGTCGAGACGCAC
GTGATCTGAGCGGGACAATCGATCTGTAGCCATTTGCGATAGTACTGTATGAAGTAATATTATACATCCCTGGGGTACAAAACCTAGCTCAAGTCGCACG
TTGCGCCCGTCAGTCAGTTTCCCCAGCGGCTCAGCTCATAACGCCCCTCACCACCAGCGCAATGCGCGTCAGTGTCTCGATGCGTGTGTCTCGCACGCTC
ACAGCGAGCAACAAGCGACCGCGATCCTCCCCACTGTGCTCCACAGCACGCAGACTCCACACGGAGCTGCAGCGCGCCATCACTCCCCAGTCGCCACCAC
CACTGGACACTGAATCTCCACCGGTGACACCCTCGCCATCATTCAGTCGCGTCTCCAATGCGCCGTCCGTGAGCGCCGCTCGCCTCGCAC