Description :
From Genome Similarity Track
Location :
Scaffold_279:8020- 11084
Transcript NameFunction/comments
Phyta_totarag6608vacuolar protein sorting-associated protein, putative

Sequence
3064 bases(100 bases per row)
ACCCAGACACTCGCGACTGGCACCCCATGTGCACGGAGTGGGCACTCGACGCGTCAGTACAGGGATCCATTTCAAGCGAGAGTGAGCTGCACGTTATTCT
CACGGCTTCGCAAGCACTGGACCTCACTGTTACCCACGGATTGTTGGAGGTCATGGCATCGGTGGGTGGCGCGTGGAAGCGTCGTGCAGCTTTAGTCGCT
GCAAAGGAACACgctgaagaaaatgaagatgaagaaatcaaGCGACGTAAAATGGCACCTTGTGTGATCCGCAACGAGACTGGGCTTCGTCTGAGCTTCT
GGCTCACAAATGGGTCTTTCACGACGGAGCCGCAAGTCGTGTCCACAGGAAGCTTGGCAGATGTTCGCTATCTTCATGCCCCAGGTCGAGGGCGCGGTGT
GGTTCGGCGATATTCTTCTGGTGACCGAGATGCTGCTAATTTACGACTCTGTCTGCAATTGATGGACTCAAAGAACACAGGTGACGGTGCAGCACGATTC
CAAGCTGTTCAAGGACTCATTTTTGAGCAGTTGGGTGCTCGCACGTTTCCTTTAGTGGACACGCACGGGCAGAGGACAAGCTTCACACTAAGTTTGTTGG
CTCAACTTGTTGAAGGTCGTATCTTGCTGGTAGTCTCGTCACCTATCAAGCTAGTTAACAGACTTGCGTCTGGCCGTCCTGTGGCACTTCTCGTAAACGA
CCCGACGTGGCACACACCAGTCGAGATTGGGATCCTACGGCCAAACCAGGACTCCGCTGTGCCAGTGCTACTTTCTCTGGCATCGGAGCTGCGTGTGCGA
CCTGTGGGGAATGGGACCACGTATTCGTGGAGCGCTCCTATCCCAGTGCAGACTCGATCCGCGGTTGAGCTTAaggtggaggcagcagtATCCTCCACAT
CAGTCTCACGTGAGAGCGTAGGCAACGATGGTAATGGTCGGAATGCCGTGTACTGCGTCTCGATGTCAAGCGATAAGGAGATGCGTGTTGTTTCAGTTGC
TGAGCCACTTGTTCTCGTCAATAAGCTGCCGGTGCCACTGACATACCGCGTGCAGTCAGCCTATAGCTCTGCTTATGGTTCAGGGACAAGTGATAGTCCA
TCAAAGCCGGAAACGATCGCTGTAGGAGCCAAGACCAGCATCTGGTGGACCGACATTGCTCAGCGACCTctgttccagctgcttgTGGAAGGCTGCACGT
CGCCGTCCAAGTGGCTAGAACTGGCACCTCGAGGGACAGCTAGTGGTGCTGTATTGTCTGTACAGCTTTCTCGCGTGGGTGATGGACGCCCGTTCcgact
tcttctgcgcgTGGTGGGGGGTACCGATCACGCGGCTCGACCTGTGCGCGTGGAGATCCTTGCCGAGGTCTGGGTCATTAACCGTTCGGGTTTAGAGCTG
GTTTATGGCACTGCCGCAGACAGTGAAGCCTACTTACCACCTcgagctgcacgtgctcaGGTGGGCAATGCCCAAATCAGTGCGTACTCGAGCGACAACA
GCGGCAAGGTGCCCGTGGTTCGTATTGGTCTGCGTGGATGCAATTGGTCGGCTCGATTTGAAGCAGACCCAAAGAGGCTGAGCTGGCAGGACGAATGCAT
TACACTCCGCTCGGCAGGGAGCAGTGCGTCTTCAGGTGGCGTGTTGTATGAGTTGGGCGTATCAGCAGACTACGCGACCAGGCATTTTGGCTCGGTCACG
ACACTTGTGAGTGTCATCCCTCGCTACCTGATCTTTAATCGATCGTCACACACGTTGTTACTGCTTGAGACTCCAAatcgccagcaccagcggctAGAGG
ATTCTAACAACGACAATGTGGCCCACCACGTACTGGGTGCAGGGGACATGTATGCGCTCTACTGGGTGAATGGAACTCGAGCCCCGCTGCGTGCATCAGT
GCTCTTGAACGACGACGCATCTGGCACGTTTTGTAGTGACGGCTATGACTGGAGTACAGCCTTTGCTGTCGATCGCGTGGCCACAACGGACTTGTTGGTG
CCACCACGCTCTAGTGGACGCGGTGTCCACTTAGAGGTGGTAGTGAAGCGAGGTAGCCTTTCCCAGACTacgttcgtggtggtggtgacagACGGAGGTG
CTAACTCCCCGACTTCTACGTCGTCAAGACTGTCAACTGCAGGCTCGACGGTCTCTTCATCTGCAAGGGATGTGGTGACAGGCACAGGAGCGGCGGGATG
GCAAACATTCAACCTCCACGCTCAGGTGGCCGGCGTGATTTTGACAGTGACCGACAAGAAACACGGCGGAATGGTTGAGGAGTCTCAGAGTTTGTTTTCC
GGTGGATCTGAGGGTGAAAGTGAGCCAGTAGCACGTGCAACGTTTACGCGGATTGGCGTGGAGGCGTCTTGGTCGCCGCAAACTACTGCTGCTAAGCTAA
ACCTCATGGGGCTCAAGGTAGAGGATCTCCTTCCACAGTCCGAGAACCGTGTCGTGCTGAGACCACTACTAAAGGGAGATGGCTCAGTGAGAGCAAGCAT
GGACAAGTCTTTCCTTGAGCTGACGTATCTCGAGAGGCCACACGCCAAGTACACGTGGGTGGAGCGTGTgcacgtggagctgcagaacgtGAAGATCTCG
ACATCCATGCGCTTCGTCGATCGGCTAAACAGACTGGAGAAGGAAACGGTTGCGCACTTTCAGCACAAGTCGCTGGTTTCTGCTTTCCCAGGCGAAGAGG
ACAGCAATGgcgaggacgtggaggaggGCGACGACTTGCTCGCCTATTTTGTGCCTCAGaatgaagaaggagaagaggaTACTAGTGCGGCCGACATGGC
AGCCATGACAGGTCGGAAGCTGTACATTGCATCGGGCGAGATCTCGCCCGTGCGTGTCGTCGTAAGTTTTTCGCGCAACAAAAGTGACTCGAGCCAGCGG
GTCAACGAAGGATTTTGGCTGTCTAACctgaagctcaagatcgagAACGCATGCGTGACGTTAGAAGGCTATCGGCTATCCCACGCGCTGGCCACGCAGG
AGTCGCTGGGTGCAGCGATCGCGCGTTTTTACGAGCAATCCGTGAAGTCGCAGGCACTCAATCT