Description :
From Genome Similarity Track
Location :
Scaffold_561:8020- 9520
Sequence
1500 bases(100 bases per row)
GGCGCCGGTAAGACCGAGTCGTCGAAGATCGTGCTCAAGCACCTGACAACGCGCGGCCTCTACGGCAAGAAGGCGCGTGGCGAGGAGATCGAGGCGCTCT
TCCGGGACCGCAAGCAACACGGCACGTCGCTGGACCACCGTCTCATTGAGCAGAACCCAATCCTGGAGGCGTTTGGTAACGCCAAGACGCTGCGAAACCA
CAACTCGAGTCGCTTCGGCAAGTTCATGAAGCTTCAGTTCACGTCGAACGGCGAGTTCAAACTCGCCGGCGCGTTCGTCGAGACGTACTTGCTCGAGAAG
TCGCGTCTCGTGTACCAGGTGGACGGCGAGCGCAACTTCCACATCTTCTACCAGCTGCTCGCGGGCGCCTCGGCGGCGGCGAAGAGCGAGTTCAAGCTCA
CCAAGCCACAGGACTTTGGGTACCTGAACCAGAGCAACTGCTACGTTGCCGAGGACACGGACGACCGCGCGTGCTTTGAGGACGTCGTGCGCGGCCTGAG
CTGCGTCGGCATGGACGACGGACTCCAGCACGTGATCTTCTCGGTCATCGCTGGTCTCCTTCACATTGGTAACATCGATTTCGACGAAGAAGACACCCCC
GAGGGCGAAGCGGCGATCATCGACAAGCCGTCGGCAAAGAACGCGCTGACGATGGCGTCCAAGCTGCTCGGCGTCCAGGAGCAGGCGCTCGCGAAGGTGA
TCATTGAGCGCGACATTGTGACGCGCGAAGAGACCTTCACGGTGCGTCGTAACGCGCAGAACGCGATCTACGCGCGTGACGCCATCGCGAAGGCGCTCTA
CGGCAGGCTCTTCGACTGGGTCATTGTGCAGGTCAACGCGTCGTTGGGCCAGGACCCTGCGCCGCTGCCGTACATTGGCGTGCTTGATATTTTCGGCTTT
GAGTCGTTCCAGCGCAACGACTACGAGCAACTGCTGATCAACTACACGAACGAAGTGCTCCAGGCGACGTTCAACAACCAAGTGTTCATTGCTGAGATGG
AGTTGTACAAGCGCGAAGGCATTACGGTCGGCAAGATCAAGTGGCCGGACAACCGTGAGTGTGTGGACCTGATTGCCGCCAAGCCGGACGGAATCCTGAG
CATCCTGGACGCGGAGTCCATGAACCCGCAGCCGAGCGACGAGAAGTTCCTCGCTGCGCTGCACCGCAAGCACACGAAGAACGCGTACTTTCCGCGCCCG
CACCCCAAGGACATGCAGCACATGTTCATTGTGCGTCACTTTGCTGGCTCGGTCTCGTACACGATCGGTGCGTTCATGGACAAGAACAATGACTCGATCC
CCCAGGACATGTCGAACCTGTTCCTGGGATCGGCCAACCACTTGGCGGTGGCGTTCTTCAAGGGCGAAGTTCCGGACAAGCCGGGCAAGAAGAAGGTGCT
TAAGAGTGTCGCTGCCAATTTTTCCAAGCAGATGCAGGAGCTCGTCGATACCTTGGACGCGACACGCTGCAACTTTATCCGTTGTATCAAGCCGAACGCG