Description :
From Genome Similarity Track
Location :
scaffold_105:8020- 9213
Transcript NameFunction/comments
Pl_109648hypothetical protein PHYSODRAFT_486841

Sequence
1193 bases(100 bases per row)
CCCAAAGTACGGGATCTCGCCATGCGGCGTCACACGAACGGCGTGGCGATTGCCCGGTAGGTAGTCATACGTGGCATAGTGAACTGTGGCGCGATTATCC
CAGATCGCCACTGCGTCCTTTGTCCAGTGGTAGCGCACCTGGAACTCGTGTCCCTGCGCGATGTGCTGGAGCAGGAAGCGCAAGACAGAATCTGCAAAAG
AAATACCGGCATATTAAACAGGGGGCCACAGCGGATGGACACATACGGTGTCAAGAACGTACCCGACTCGGTTGCGGACAAGTTGTTGATTCGAGTGGTG
AACTGGGCGTTCACGTATAAAGCCTTGCGACCAGTCACAGGGTGAGTGCGAACAACCGGGTGCTCAAACTCCACAATGGGACGGCGAAGGGTCTGGCCGT
TGGCGATCGCAGACTCAGCTTGGTGCTGCATCAAACAACTAACCGATAAGACTCGGCTCCACCTACAATTTTGGAAGCACTACCCACCTTGCTGCTGTGG
ATTGCCGTGAGTCCCTCCACAAACTTCTTGAATTGCGGGGTGAGGCGGTCGTATGCCTCGTACGCTGACGCCCATAAGGTGTCACCACCTGTGGGCGGGG
TGGTCAAGACCTTGAAACTCGTGTACGATGGAGGCTTTCAACAGTATCATAAGCACAGGTTAGTATCTAAGTCGATCGATATTCAACAAGTTCTTGTACC
TGACGTTCGTAGGACACATCACTGTGCCATTGGTTAACGTGATTGTAGAGCTGCGACTCGATGCGTTTTCGACTACCCTCAAGGGAGTTTTCCACCACGT
GCACCTCGGGAATTCCCTTTGCATGAGCAACCGTCTGGTGGACGTGCAAAGGACCACAGTAGCGACCCAGATCCAACTGCTCTTCGATCGAGATCTTCTG
GTCACGGAGAAATACCACGCCTCGATGAGCAATAAGCAGTGCTAGCTCGTCCTTCTGTGTGTCTGTCAACTCGTGTAGCTGCAGACCCGAGATCTCAGTT
CCGATCTTCGGTTCTAGGTGCGTCACGGTTGCGTCGGCCAACAGGTTCTTGAAGGTCGGGTCAGCCTTTAGTGCACGGTCCTCGTAGGGCACCACAGGGA
TCGGGTCGTACGTCTTGGTGGGAAATTCGCCAAGCAGTTCCGGGTGGGTGAATGGGGCATGCTCGACTTCGAGGTTGAGCGCGTTCTTGATGG